Publicaciones Científicas
Investigación y divulgación científica sobre especies marinas y conservación.
-
Shark species composition and catch variability in Guatemala’s artisanal Pacific fishery: A call for spatial and temporal management
Contents lists available at ScienceDirect Regional Studies in Marine Science journal homepage: www.elsevier.com/locate/rsma Shark species composition and catch variability in Guatemala’s artisanal Pacific fishery: A call for spatial and temporal management Maria de Belen Chacón-Paz a , Julio Sánchez-Jiménez a , Elisa Areano a , Juan Carlos Pérez-Jiménez a Fundación Mundo Azul, Km 21.5 carretera a Villa Canales, Guatemala City, Guatemala b El Colegio de la Frontera Sur, Av. Rancho Polígono 2-A, Ciudad Industrial, CP. 24500, Lerma, Campeche, Mexico Abstract: Artisanal shark fisheries along the Pacific coast of Guatemala operate with minimal regulation, raising concerns about the sustainability of catches and the conservation of vulnerable species. In support of Guatemala’s National Plan of Action for Sharks, Rays, and Chimeras (NPOA-Guatemala), this study aimed to (1) update the inventory of shark species landed in artisanal fisheries and (2) assess seasonal and annual variation in catch rates, size structure, sex ratios, and maturity stages of the most frequently landed species. From 2017–2024, 2386 monitoring days yielded data from 9527 fishing trips across key communities. A total of 24,987 sharks from 14 species were recorded, with five species, Sphyrna lewini, Rhizoprionodon longurio, Carcharhinus falciformis, Mustelus lunulatus, and C. limbatus, accounting for 98.5% of landings. Notably, 78.5% of the recorded species are classified as threatened by the IUCN, and the catch was heavily dominated by early life stages. Seasonal size trends indicated a consistent presence of these stages in coastal waters (captured in fishing operations conducted within 30 km of the shoreline), with this pattern occurring consistently across years. CPUE and size structure exhibited spatial and seasonal variation patterns, likely influenced by differences in gear selectivity, habitat characteristics,and the non-standardized nature of the CPUE estimates. However, these findings highlight the potential value of spatial and temporal management strategies and the need for further research, community-based monitoring, and co-management initiatives to refine, guide and strengthen their implementation in the artisanal fisheries of the coastal communities studied along the Guatemalan Pacific coast. * Corresponding author. E-mail address: jcperez@ecosur.mx (J.C. Pérez-Jiménez). https://doi.org/10.1016/j.rsma.2026.105113 Received 17 December 2025; Received in revised form 29 May 2026; Accepted 1 June 2026 Available online 5 June 2026 2352-4855/© 2026 The Author(s). Published by Elsevier B.V. This is an open access article under the CC BY license ( http://creativecommons.org/licenses/by/4.0 ). 1. Introduction Guatemala’s Exclusive Economic Zone (EEZ) encompasses approximately 110,944 km², including a continental shelf of 14,009 km² and 254 km of coastline. These marine and coastal areas support commercially important populations of teleost fishes, crustaceans, and elasmobranchs. Although fisheries contribute only 0.2% to the national Gross Domestic Product (GDP), they remain a vital source of food security and employment for coastal communities. Nevertheless, the exploitation status of most fishery resources in the country remains poorly understood due to the lack of a permanent fisheries monitoring and assessment program (FAO, 2018). Guatemala’s General Fisheries and Aquaculture Law defines the procedures for obtaining fishing licenses and permits, yet critical information, such as the number of active fishers, fishing vessels, and total fishing effort, remains incomplete. It is estimated that around 20,000 artisanal fishers operate nationwide, with approximately 70% based on the Pacific coast, where catch volumes are highest (FAO, 2018). Catch estimates vary considerably: Lindop et al. (2015) reported annual landings between 24,721 and 54,896 tons during 2000–2010, while FAO (2018) reported values ranging from 10,000 to 38,000 tons for the same period, highlighting the uncertainty in official records. Artisanal fisheries in the Pacific and Caribbean coasts of Guatemala primarily use small (6–7 m) outboard motorboats. Elasmobranchs, whether targeted or caught as bycatch, are primarily captured using longlines and gillnets, which are the predominant fishing gears in both the Atlantic and Pacific coasts of Guatemala (Hacohen-Domene et al., 2020; Avalos-Castillo and Santana-Morales, 2021). However, the absence of systematic landing monitoring programs and species-specific regulations for elasmobranchs has resulted in a lack of reliable data on annual catch estimates at the species level. The only available figures are from FAO (2018), which reports national shark catches fluctuating between 90.7 and 408 tons from 2002 to 2015. Despite these information gaps, recent studies have provided important insights into the catch composition of elasmobranchs in both artisanal and industrial trawl fisheries on the Pacific coast. Avalos-Castillo and Santana-Morales (2021) documented 21 elasmobranch species landed by the artisanal fleet from 2017 to 2020, including ten shark and eleven ray species. The most frequently reported species were the longtail stingray (Hypanus longus, 47.88%), the scalloped hammerhead shark (Sphyrna lewini, 33.26%), and the Pacific sharpnose shark (Rhizoprionodon longurio, 7.97%). Meanwhile, Sánchez-Jiménez et al. (2023) reported the capture of 13 elasmobranch species in the shrimp trawl fishery between 2017 and 2022, including 11 ray species and two shark species. The most commonly landed were the vermiculate electric ray (Narcine vermiculata, 32.03%), the spinetail round ray (Urotrygon aspidura, 29.85%), the whitesnout guitarfish (Pseudobatos leucorhynchus, 13.68%), and the giant electric ray (Narcine entemedor, 9.55%). However, temporal analyses of catch composition and catch rates remain largely absent. The National Plan of Action for the Conservation and Management of Sharks, Rays, and Chimaeras (NPOA-Guatemala) identifies the urgent need to address major information gaps. Key priorities include the long-term collection of data on catch composition (e.g., size, sex, maturity), fishing effort, and catch rates to establish baseline indicators for evaluating fishing impacts and supporting management decisions. In this context, the present study aims to: (1) update the inventory of shark species recorded in the landings of artisanal fisheries along the Guatemalan Pacific coast, and (2) estimate the seasonal and annual variability in catch rates, size structure, sex ratios, and maturity stages of the most frequently landed species. 2. Material and methods 2.1. Ethical statement In this study, no experiments with animals were performed. Specimens were recorded as part of fishery-dependent surveys. Therefore, all examinations were made upon deceased animals captured during commercial fishing operations. 2.2. Study area Elasmobranch landing data were collected from six artisanal fishing communities along Guatemala’s Pacific coast: Champerico, El Dormido, Las Lisas, Buena Vista, San José, and Sipacate (Fig. 1). However, the majority of records originated from Las Lisas, Buena Vista, and Sipacate. Guatemala’s Pacific continental shelf is relatively narrow, extending approximately 50 km offshore, and spans an area of 14,009 km². Along the 254 km coastline, around 45 communities engage in artisanal fisheries where elasmobranchs are commonly landed as bycatch(Ávalos-Castillo and Santana-Morales, 2021). Las Lisas is located within the Chiquimulilla wetland in the department of Santa Rosa. Sipacate, in the department of Escuintla, lies within the Sipacate-Naranjo National Park, a coastal protected area approximately 20 km long and 1 km wide, comprising mangrove forests, lagoons, and sandy beaches (CONAP, PNUD, 2017). Unlike the other sites, Buena Vista does not fall within the boundaries of any formally recognized wetland or protected area. 2.3. Fishery-dependent monitoring Monitoring activities were conducted from May 2017 to February 2020 by trained biologists from the Blue World Foundation (Fundación Mundo Azul). From March 2020 to December 2024, the monitoring was continued by a combined team of biologists and trained local fishers as part of a Citizen Science program. A total of 2386 monitoring days were completed, during which 9527 landing events from artisanal fishing boats were recorded. These boats are typically fiberglass vessels ranging from 7.5 to 9 m in length and equipped with outboard motors. The fisheries primarily targeted teleosts and rays using monofilament gillnets (typically ~600 m in length, with mesh sizes ranging from 4 to 6 cm), which were deployed either at the bottom or in midwater. In addition, bottom longlines were used, equipped with J-hooks or Eagle Claw half-circle hooks, with longline sets comprising approximately 400–1100 hooks, with hook sizes ranging from 3 to 6 cm. Fishing trips typically lasted 1–2 days, during which fishers conducted between one and five sets. These values represent approximate ranges and may vary among vessels, crews, and fishing operations. Additionally, due to the fishing fleet type, precise georeferenced fishing locations were not recorded; however, we documented that fishing operations occur along the coastal zone, from the coastline to a maximum distance of 30 km offshore. The intensity and frequency of monitoring varied throughout the study period due to changes in weather, fishing effort, resource availability, and market demand. Standardization of catch data was not feasible due to variability in gear type, gear quantity, and target species. In many instances, fishers used a combination of gillnets and longlines within the same fishing trip. However, beginning in 2020, the number of operational boats per day was consistently recorded in Las Lisas, Buena Vista, and Sipacate, allowing the calculation of Catch per unit effort (CPUE) as the number of sharks landed per boat. In this study, CPUE is used as a relative index of catch rates derived from fishery-dependent monitoring rather than as a standardized estimate of abundance. Because monitoring effort varied spatially and temporally among communities and years, and fishing gear characteristics (e.g., number of hooks in longlines, net length, and soak time) were not standardized across vessels, CPUE values should be interpreted cautiously. These variations in fishing effort, gear configuration, and monitoring coverage may influence catch rates and limit direct comparisons among fishing communities, bimesters or years. Therefore, the CPUE estimates presented here are only intended to describe relative patterns in shark catches within the monitored communities. Fig. 1. Location of the fishing communities of Champerico, El Dormido, Las Lisas, Buena Vista, San José, and Sipacate on the Pacific coast of Guatemala. 2.4. Biological data collection Specimens were measured to the nearest centimeter. Total length (TL) was measured in a straight line from the tip of the snout to the tip of the caudal fin in its natural position (Compagno, 1984). Sex determination was performed macroscopically based on the presence or absence of claspers. Individuals were classified as mature or immature. Males were considered mature if they had fully calcified claspers (Clark and von Schmidt, 1965). Females were considered mature if they were pregnant, or, if not pregnant, based on species-specific size-at-maturity thresholds reported in the literature (Compagno, 1984; Castro, 2011; Ebert et al., 2021). 2.5. Statistical analysis Data on CPUE, size structure, sex ratios, and maturity stages were analyzed to evaluate both seasonal (bimester periods) and annual trends. Normality and homogeneity of variance were assessed prior to statistical testing. Where assumptions of normality and equal variance were met, t-tests or one-way ANOVAs were used. If these assumptions were violated, non-parametric tests (Mann–Whitney U
View PDF -
Combining monitoring approaches to reveal deep‑water chondrichthyans diversity in the Caribbean waters of Guatemala
https://doi.org/10.1007/s12526-026-01657-x Combining monitoring approaches to reveal deep‑water chondrichthyans diversity in the Caribbean waters of Guatemala Ana Cristina Hérnandez‑Solis 1 · Julio Sánchez‑Jiménez 1 · Elisa M. Areano‑Barillas 1 · Juan Carlos Pérez‑Jiménez 1,2 Received : 26 July 2025 / Revised: 28 January 2026 / Accepted: 13 April 2026 © The Author(s), under exclusive licence to Senckenberg Gesellschaft für Naturforschung 2026 Communicated by F. A. Martinez Juan Carlos Pérez‑Jiménez jcperez@ecosur.mx 1 Fundación Mundo Azul, Km 21.5 Carretera a Villa Canales, Guatemala, Guatemala 2 El Colegio de La Frontera Sur, Av. Rancho Polígono 2‑A, Ciudad Industrial, 24500, Lerma, Campeche, México Abstract Between 2015 and 2025, a total of 124 deep-water chondrichthyan individuals were recorded in El Quetzalito, Guatemala, through fishery-dependent monitoring (n=86) and fishery-independent longline surveys (n=38), representing seven shark species, one skate, and one chimaera. The gulper shark (Centrophorus granulosus) was the most recorded species across both surveys, with females and immature individuals present among the captures. Catch per unit effort (CPUE) for C. granulosus showed a decreasing trend in both monitoring approaches, underscoring the importance of continued monitoring to better understand these patterns. Other species recorded included Hexanchus vitulus, Squalus cubensis, Neoharriotta carri, and several rare or single-occurrence taxa. Fishery-independent data revealed species not seen in recent commercial landings, such as S. cubensis, emphasizing the value of complementary survey methods to detect underreported taxa in artisanal fish- eries. The predominance of mature females in commercial landings and immature individuals in research surveys suggests differential spatial or behavioral patterns that may influence catchability. This study provides a baseline for understanding deep-water elasmobranch diversity in the region and highlights the importance of combining fishery-dependent and fishery- independent approaches to generate data on these little-known and vulnerable species. Introduction Deep-water ecosystems are among the least studied environments worldwide (Ramirez-Llodra et al. 2010; Costello et al., 2017; Finucci et al. 2022, 2024). Despite increased deep-water exploration and resource exploitation in recent decades, scientific surveys remain limited, particularly in remote regions, resulting in an incomplete understanding of deep-water biodiversity (Danovaro et al. 2014; Miller et al. 2018; Finucci et al. 2022). Deep-water species represent the most diverse yet understudied group among chondrichthyans (cartilaginous fishes, including sharks, rays, and chimaeras) (Finucci et al. 2022). These species primarily inhabit depths exceeding 200 m throughout their life cycle (Kyne and Simpfendorfer 2007). Nearly half of all known chondrichthyan species are classi- fied as deep-water species (Cotton and Grubbs 2015) and given the vast unexplored regions of the deep sea, many more are likely to remain undiscovered (Finucci et al. 2022). Deep-water chondrichthyans play crucial ecological roles by linking pelagic, mesopelagic, and benthic ecosystems through trophic interactions. They prey on mesopelagic, benthopelagic, and demersal fishes and invertebrates, while some species also scavenge on marine mammals and dis- carded fisheries catch, contributing to nutrient cycling in deep-sea ecosystems (Cotton and Grubbs 2015; Kyne and Simpfendorfer 2010; Pethybridge et al. 2012). Nevertheless, despite their important role in maintaining ecosystem balance, deep-water chondrichthyans can be particularly vulnerable to overfishing due to a combination of biological traits and increasing fishing pressure in deep-sea habitats (Kyne and Simpfendorfer 2010). Their life-history characteristics, such as slow growth, late sexual maturity, low fecundity, long gestation periods, and extended lifespans, are evolutionary adaptations to the extreme conditions of the deep sea, including low temperatures, high hydrostatic pressure, limited food availability, and the absence of sunlight, which restricts primary production (Tyler et al. 2016; Finucci et al. 2022). For instance, species such as Centrophorus granulosus, Dalatias licha, and Deania calceus exhibit very low intrinsic rates of population increase and are currently listed as Vulnerable to Critically Endangered on the IUCN Red List. Additionally, they experience relatively low predation pressure, with larger sharks as their primary natural predators. Their reproductive strategy, producing only a few offspring capable of reaching maturity, has been successful in stable, predator-limited environments; however, it leaves them highly susceptible to population decline under human exploitation (Cortés, 2000; Rigby and Simpfendorfer 2015). Deep-water chondrichthyans exhibit even lower productivity than their coastal and pelagic relatives, making their populations less resilient to fishing pressure and more prone to depletion (García et al. 2008; Simpfendorfer and Kyne 2009). In recent decades, the expansion of deep-water fisheries has significantly increased pressure on deep-water chondrichthyans, particularly in regions where bottom trawling and bottom longlining are prevalent (Baremore et al. 2021; Talwar et al. 2022). Many deep-water sharks are caught as bycatch or targeted for their meat, liver oil, and fins, yet their slow life cycles mean that even low levels of fishing can cause severe population declines. Given their limited capacity for recovery, continued exploitation without effective management could push many deep-water chondrichthyans toward extinction (García et al. 2008; Simpfendorfer and Kyne 2009). In the review by Finucci et al. (2024), it was found that most deep-water chondrichthyans (87.7%) are caught incidentally in trawl, longline, and gillnet fisheries targeting species such as grenadiers and hakes. Meanwhile, 11.6% of deep-water chondrichthyans are directly targeted in fisheries. However, targeted fishing is a major concern among threatened species, affecting 35% of species, particularly those from three families: gulper sharks, dogfishes, and hardnose skates (Finucci et al.2024). Bycatch in deep-water trawling and longline fisheries remains a significant conservation issue, often leading to population declines (Kyne and Simpfendorfer 2010). Additionally, habitat degradation and the expanding footprint of industrial fisheries further threaten these species, highlighting the urgent need for improved management and conservation strategies. Although no published data are available describing a direct expansion of Guatemalan Caribbean fisheries into deep-sea habitats, regional studies indicate that similar fisheries in the western Atlantic have increasingly shifted to deeper waters following declines in coastal resources (Baremore et al. 2021; Talwar et al. 2022). Based on these documented patterns, a comparable expansion may occur in the Guatemalan Caribbean, particularly along the Cayman Trench. However, the extent to which local fisheries may transition into deeper habitats remains largely unknown. Artisanal fishers from El Quetzalito reported that deeper fishing grounds yield higher catches of groupers and occasional pelagic sharks, making these areas attractive; nevertheless, these observations should be interpreted as local perceptions rather than evidence of a systematic expansion. Since 2015, efforts led by the Blue World Foundation, in collaboration with artisanal fishers, have resulted in the documentation of at least eight deep-water chondrichthyan species in Guatemalan waters. Notable among these are Centrophorus granulosus (Endangered) and Dalatias licha (Vulnerable), both species of conservation concern due to their limited reproductive potential and susceptibility to overexploitation. Other recorded species include Hexanchus griseus, Heptranchias perlo, Squalus cubensis, Scyliorhinus hesperius, Hexanchus vitulus, Cirrhigaleus asper, and the chimaera Neoharriotta carri. Several of these represent recent and significant findings for the country’s marine fauna. For example, the first national records of S. hesperius, H. perlo, N. carri, and H. vitulus were reported by Hacohen-Domené et al. (2016a, 2016b), Polanco-Vásquez et al. (2017), and Avalos-Castillo et al. (2020), respectively, while D. licha and H. griseus were added to the list more recently by Sanchez-Jiménez et al. (2024a, 2024b). Although every year the Ministry of Agriculture, Live- stock, and Food (MAGA), through the Directorate of Fisheries and Aquaculture Regulation (DIPESCA), establishes a 4-month closed season for sharks and rays, the current impact of fishing on deep-water chondrichthyans in the region remains unknown due to the lack of species-specific monitoring and reporting. The main objective of this paper is to describe the diversity and catch composition of deep-water chondrichthyans in both fishery-dependent and fishery-independent surveys conducted in the Caribbean of Guatemala. This study aims to provide essential baseline information to inform future conservation strategies and enhance the management of these vulnerable and understudied species. Material and methods Study area The study was conducted in the coastal community of El Quetzalito (Fig. 1), located in the municipality of Puerto Barrios, Izabal, Guatemala. Since 2015, Fundación Mundo Azul (Blue World Foundation) has been conducting chondrichthyan landing monitoring in this community. Recently, in 2022, the organization initiated scientific longline surveys in the deep waters of Guatemala’s Caribbean territorial sea, within the marine area of the Punta de Manabique Wildlife Refuge (RVSPM), which borders El Quetzalito. Fig. 1 Study area in the Guatemalan Caribbean showing bathymetry(m) and the location of the coastal community of El Quetzalito. The inset map (upper left) indicates the location of Guatemala within Central America, while the main panel depicts the Caribbean Sea, highlighting the deep-sea geomorphological features of the Cayman Trench Fishery‐dependent monitoring surveys Local fishers and youth from El Quetzalito were trained to conduct landing monitoring of chondrichthyans caught during artisanal fishing operations. These monitors formed part of a Citizen Science Program. Monitors recorded data on species composition, specimen count, total length (± 1cm), fishing gear used, and the number of boats returning from fishing trips each day. A total of 65artisanal fishing trips were recorded between February 2015 and April 2025, in compliance with the closed season for sharks and rays. The ban on shark fishing occurred from May to August, and the ban on ray fishing occurred from June to September. Catch per unit effort (CPUE) was calculated for each species as the total number of individuals reported in a given year divided by the total number of fishing trips conducted that same year. Additionally, a global CPUE was calculated by dividing the total number of individuals reported across all years by the total number of fishing trips during the study period. The monitoring program documented a total of 658 fishing trips during the study period; however, only the 350 bottom longline sets were included in the analysis, as longlines operate in deeper waters than gillnets and therefore provide a more reliable measure of encounterability with deep-water chondrichthyan species. Each longline set is deployed once per day and retrieved the following day, enabling artisanal fishers to access deeper habitats where these species may occur. The monitoring program operates daily and provides coverage of three artisanal vessels. Artisanal longlines consist of four polypropylene sections (8 mm × 425 m each), for a total length of 1500–1700 m, and carry approximately 220 non-offset circle hooks (size 9/0). Lines are anchored at both ends and baited with shad (Opis
View PDF -
Richness and abundance of reef fish in the Caribbean of Guatemala using Baited Remote Underwater Video Stations
Richness and abundance of reef fish in the Caribbean of Guatemala using Baited Remote Underwater Video Stations *Francisco Polanco-Vásquez 1, 2 , Alerick Pacay 2 , José R. Ortíz-Aldana 1 , Ana Hacohen-Domené2, Cristopher Avalos-Castillo 2 1 Instituto de Investigaciones Hidrobiológicas, Centro de Estudios del Mar y Acuicultura (Cema), Universidad de San Carlos de Guatemala (Usac); 2 Fundación Mundo Azul (FUNMZ), Guatemala *Author to whom correspondence should be addressed: polancoenca@gmail.com Received: March 15, 2017 / 1st revision: March 20, 2018 / 2nd revision: May 31, 2018 / Accepted: September 24, 2018 Abstract The Guatemalan Caribbean Sea forms part of the Mesoamerican Reef System (MAR), which harbors a great marine biodiversity. These populations are important for the wellness of humans who live in communities at coastal areas located in the MAR region, and who directly or indirectly depend on these resources to survive and thrive. The main objective of this study was to determine not only species richness and abundance of herbivorous fish, but also those who are attracted by shad and tuna bait when used in the Baited Remote Underwater Video Stations (BRUVS) in sites with coral reef presence. Monitoring was held at seven spots located outside Bahía de Amatique, Izabal, in April, June and September 2016. In 21 sets of BRUVS, 26.06 h of video were recorded, counting a total of 778 organisms which belongs to two classes, 20 families, 31 genera and 59 species. The most abundant species were Scarus spp. (19.67 %), Clepticus parrae (9.64 %), Aluterus scriptus (6.04 %), Scarus iserti (5.14 %) and Caranx ruber (5.01 %). The sites that presented higher richness of species were Quetzalito 1 y 2 (p < 0.006 compared to the rest of the sampled sites). Quetzalito 1, 2 and King Fish showed higher abundance ( p < .038) compared to the rest of the sites. Abundance per specie dendrogram showed five groups (Bray-Curtis similarity of 43 %). Finally, low presence of commercial fish species was seen at the seven monitored sites. Keywords Amatique Bay, Scaridae, Scarus , BRUVS. Introduction The Mesoamerican Reef System (MAR) is a living structure that extends for more than 1,000 km along the marine-coastal zone of its four member countries (Mexico, Belize, Guatemala and Honduras). This region is considered highly important, both biologically and socioeconomically, since it sustains a large part of the local economy of the coastal communities settled within the MAR (Kramer et al., 2015). The MAR is the second largest coral reef in the world and holds a wide variety of coastal ecosystems such as mangroves, seagrass beds, mud flats and coral reefs (Adams et al., 2006; Mumby et al., 2004; Vásquez, Vega, Montero, & Sosa, 2011). Historically, scientific research on fish communities relied on invasive and destructive monitoring in order to reduce statistical sampling error (Ackerman & Bellwood, 2000). Later, these methods were replaced by dives, in which divers recorded abundance data and estimated fish sizes within the limits of established transects. However, several inconsistencies were detected regarding the abundance and size of the organisms, owing to variation in the criteria applied by the researchers (Harvey, Fletcher, Shortis, & Kendrick, 2004). At present, there is no standardized non-invasive methodology that allows the effectiveness of conservation objectives to be evaluated and that can be applied and replicated in continuous monitoring within marine protected areas (De Vos, Götz, Winker, & Attwood, 2014). In this regard, the Baited Remote Underwater Video Stations (BRUVS) methodology is very useful, since it is efficient for the analysis of fish communities, requires less sampling effort than other methods and shows greater sensitivity in detecting statistical differences in the abundances of different communities (Bernard & Gotz, 2012; Harvey et al., 2012). In addition, using this methodology can reduce field time and the number of trained personnel required, and it may prove more efficient than the use of divers (Watson, Harvey, Anderson, & Kendrick, 2005). BRUVS consist of a PVC structure that carries an underwater video camera and a metal bait mesh placed within the field of view of the camera. This methodology is used in sensitive marine habitats and in areas of complex bathymetry. It has also become a non-invasive sampling technique for reef fish, mainly where access with scuba diving equipment is difficult and where sampling could compromise the conservation objectives of the area or the reliability of the data (Cappo, Speare, & De´ath, 2004; De Vos et al., 2014). This methodology can be used to determine species richness in relation to the assemblage structure of the ichthyofauna in coral habitats (Cappo et al., 2004; Cappo, Stowar, Syms, Johansson, & Cooper, 2011; Meekan & Meeken, 2006). Some authors have used this methodology and its unbaited variants to determine populations of both bony fishes and top predators in the MAR (Andradi-Brown et al., 2016b; Bond et al., 2012). This has made it possible to determine the presence-absence of these organisms in reef ecosystems, taking into account the sizes and abundance of different species. The collapse of coral reefs in the Caribbean has been attributed in part to the overfishing that has historically occurred in the region (Newman, Paredes, Sala, & Jackson, 2006). In this sense, the main objective of the present study is to evaluate the abundance and richness of reef fish species, both herbivorous fish and species of commercial importance, at seven coral sites in the Caribbean Sea of Guatemala using the BRUVS methodology. Materials and methods Study area and sampling sites The study was carried out at seven sites with coral reef presence in the Caribbean Sea of Guatemala, located at a depth range of 5-11 m, outside Amatique Bay: Quetzalito 1 (QUE1), Quetzalito 2 (QUE2), Motagüilla 1 (MOT1) and Motagüilla 2 (MOT2), which are reef ecosystems formed by valleys and ridges, and Cabo Tres Puntas 1 (CTP1), Cabo Tres Puntas 2 (CTP2) and King Fish (KIN), which are smaller reef patches. The sampled sites are open to fishing. All the sites were selected on the basis of the coral reef ecosystems present in the area (Figure 1). In total, three sampling campaigns were carried out applying the BRUVS methodology in April, June and September 2016. All replicates were conducted in the morning, at each site at the same time of day and without randomization. Description of the BRUVS Portable GoPro Hero® 3 and 4 cameras were used, hooked onto a wooden board mounted on a triangular tripod-shaped structure built with polyvinyl chloride (PVC) pipes. To prevent the structure from moving, steel bars were placed at its base as ballast. The bait used during the monitoring was shad and tuna, placed at the far end of a 1.5 m long pipe, inside a bag made of metal mesh with a 2.5 cm opening. The BRUVS were attached to a 20 m long rope and a white buoy, and each unit was submerged for approximately one hour (Figure 2). Finally, the geographic coordinates were recorded at each sampling site. The analysis was carried out by watching the videos with Windows Media Player© software. Video analysis began at minute five (5:00 min), the moment when the boat had already left the site. Once the hour of filming was completed, the team approached the site to retrieve the structure (Brooks, Sloman, Sims, & Danylchuk, 2011). The species observed in the videos were identified to the lowest possible taxon using reef fauna identification guides (Carpenter, 2002; Humann & DeLoach, 2014). Finally, the specimens of each observed species were counted in order to calculate species richness and abundance at each sampling site. Statistical analysis For each sampling site, every species appearing within the video frame was identified and counted. With this information, a Kruskal-Wallis (1952) analysis of variance was performed to establish whether there were significant differences in species abundance and richness among sites. In addition, the Friedman-Dunn (1937) test was used to establish which mean was higher or lower. To calculate estimated diversity, the non-parametric diversity estimators Chao 1 and the Abundance-based Coverage Estimator (ACE) were used; likewise, a species accumulation curve was produced with the EstimateS software, Version 9.1.0 (Colwell, 2013). To evaluate the heterogeneity of species among the sampling sites, the Shannon-Weaver diversity index (H’) and Pielou’s evenness index (J´) were analyzed with the PAST software (Statistical Version 1.93 for Windows XP). The Shannon-Weaver index (H) was also converted into the effective number of species using the following equation: 1D = exp (H’) Cluster analysis was applied using the Bray-Curtis index to calculate and visualize the similarities among sites, taking into account the abundances of the organisms. The grouping of the sampling sites based on fish abundance was explored through non-metric multidimensional scaling (NMDS) analysis. Results A total of 26.06 h were recorded in 21 BRUVS sets distributed across seven sampling sites. A total of 778 organisms were counted, corresponding to two classes, 20 families, 31 genera and 59 fish species (Table 1). The most abundant species in the study were Scarus spp. (19.67 %), Clepticus parrae Bloch & Schneider, 1801 (9.64 %), Aluterus scriptus Osbeck, 1765 (6.04 %), Scarus iserti Bloch, 1789 (5.14 %) and Caranx ruber Bloch, 1793 (5.01 %). The remaining species each showed an individual percentage abundance below 5 %. The expected richness of the species accumulation curve shows that with seven sampling sites the curve has not yet reached the asymptote; therefore, an increase in the number of species can be expected if the number of sampling sites were increased. The non-parametric diversity estimator ACE estimated 66 species, while Chao 1 estimated 63 species (Figure 3). Significant differences were found in species richness (p = .006) and abundance (p = .038) among the sampling sites, but no differences were found for these same variables among the sampling months (p = > .999). The sites with the highest richness were QUE1 and QUE2, with 35 and 28 fish species respectively, while CTP1 and MOT1 were the sites with the lowest number of species (14). With regard to abundance, QUE1 and QUE2 were the sites with the highest number of organisms, with 259 and 119 fish respectively, while CTP2 (54 organisms) and MOT1 (44 organisms) showed the lowest abundance (Table 2). Table 1 Taxonomic list and abundance (No. of organisms/hour of recording) of reef fish in the Caribbean of Guatemala Family Species QUE1 QUE2 CTP1 CTP2 MOT1 MOT2 KING Total Acanthuridae Acanthurus chirurgus 6 9 2 0 3 5 0 25 Acanthuridae Acanthurus spp. 1 3 0 0 0 0 0 4 Acanthuridae Acanthurus coeruleus 8 0 0 0 0 0 0 8 Acanthuridae Acanthurus bahianus 0 0 0 0 0 2 0 2 Balistidae Balistes vetula 4 1 0 0 0 0 0 5 Carangidae Caranx crysos 0 4 0 0 0 0 7 11 Carangidae Caranx latus 0 0 0 0 0 2 0 2 Carangidae Caranx ruber 13 5 14 0 4 0 3 39 Carangidae Caranx spp. 4 0 0 0 0 1 2 7 Chaetodontidae Chaetodon striatus 0 2 3 1 0 0 22 28 Chaetodontidae Chaetodon capistratus 2 7 15 0 5 1 0 30 Chaetodontidae Chaetodon ocellatus 1 2 0 0 0 4 0 7 Haemulidae Haemulon macrostomum 0 0 0 1 0 3 5 9 Haemulidae Anisotremus virginicus 0 0 0 0 0 0 3 3 Haemulidae Haemulon plumierii 0 1 1 1 0 0 6 9 Haemulidae Haemulon album 0 0 0 0 0 1 0 1 Labridae Halichoeres spp. 5 2 0 1 4 6 0 18 Labridae Thalassoma bifasciatum 9 8 0 2 2 0 0 21 Labridae Halichoeres radiatus 0 0 0 0 1 0 0 1 Labridae Halichoeres bivittatus 0 0 0 3 0 0 0 3 Labridae Halichoeres garnoti 14 4 0 6 2 0 1 27 Labridae Clepticus parrae 72 3 0 0 0 0 0 75 Labridae Bodianus rufus 1 3 0 5 1 0 15 25 Lutjanidae Ocyurus chrysurus 1 2 5 2 0 4 4 18 Lutjanidae Lutjanus apodus 1 0 0 0 0 0 1 2 Lutjanidae Lutjanus synagris 0 2 0 2 0 4 6 14 Lutjanidae Lutjanus analis 3 2 0 2 0 0 0 7 Lutjanidae Lu
View PDF -
First reports of smalltooth sand tiger sharks (odontaspis ferox), off the Continental Ecuador
First reports of smalltooth sand tiger sharks, Odontaspis ferox (Elasmobranchii: Lamniformes: Odontaspididae), off the continental Ecuador Colombo ESTUPIÑÁN-MONTAÑO 1 , Felipe GALVÁN-MAGAÑA 2 *, Ana HACOHEN-DOMENÉ 3 , and Jose F. ESTUPIÑÁN-ORTÍZ 1 1 Fundación Alium Pacific, Santiago de Cali, Colombia 2 Instituto Politécnico Nacional, Centro Interdisciplinario de Ciencias Marinas, La Paz, Baja California Sur, México 3 Fundación Mundo Azul, Guatemala, Guatemala Estupiñán-Montaño C., Galván-Magaña F., Hacohen-Domené A., Estupiñán-Ortíz J.F. 2016. First reports of smalltooth sand tiger sharks, Odontaspis ferox (Elasmobranchii: Lamniformes: Odontaspididae), off the continental Ecuador. Acta Ichthyol. Piscat. 46 (3): 251–253. * Correspondence: Dr. Felipe Galván-Magaña, Av. Instituto Politécnico Nacional s/n. Colonia Playa Palo de Santa Rita, La Paz, Baja California Sur, C.P. 23096, México, e-mail: (FGM) galvan.felipe@gmail.com, (CEM) goliathcem@gmail.com, (AHD) anahacohen@gmail.com, (JFEO) felixes55@yahoo.es. Abstract The first report of two smalltooth sand tiger sharks, Odontaspis ferox (Risso, 1810), off the continental Ecuador is presented herewith. The specimens were captured by the Ecuadorian fishing fleet and landed in Manta and Puerto López Canton, Ecuador. The juvenile female specimen was registered in November 2008 and the adult male in July 2009. Both of the specimens recorded extend the geographic range of distribution of O. ferox in the tropical eastern Pacific Ocean. Keywords Ecuadorian biodiversity, range of distribution, new occurrence, Ecuadorian Pacific The industrial and artisanal fisheries are important economic activities in Ecuador. The city of Manta is the fishing port where the largest volumes of sharks are landed (almost 40 000 sharks each year). As many as 30 shark species are caught off the country’s coast. Species of the family Alopiidae have the highest catch volumes followed by Carcharhinidae, Sphyrnidae, Triakidae, Squatinidae, and Lamnidae (Estupiñán-Montaño, personal observation). The family Odontaspididae is distributed in warm temperate and tropical seas with members of this family generally living near the coast and in deep waters. Their wide geographical distribution includes all oceans, coastal waters, and surface and deep waters (down to 1600 m). This family includes two genera: Carcharias and Odontaspis and four species: the sand tiger shark, Carcharias taurus Rafinesque, 1810; the Indian sand tiger shark, Carcharias tricuspidatus Day, 1878; the smalltooth sand tiger shark, Odontaspis ferox (Risso, 1810); and the bigeye sand tiger shark, Odontaspis noronhai (Maul, 1955). All known species of this family are large (>360 cm total length) (Compagno 1984). In the central eastern Pacific only one species has been identified: Odontaspis ferox, which is distributed from southern California to the Gulf of California (Compagno 1984, Fischer et al. 1995). The smalltooth sand tiger sharks, O. ferox, have also been reported off the coast of Cocos Island, Costa Rica, Malpelo Island, Colombia (Robertson and Allen 2002), the Galapagos Islands, Ecuador (Acuña-Marrero et al. 2013, Ritter and Compagno 2013), and Isla San Ambrosio, Chile (Long et al. 2014). The presently described findings constitute the first fishing record of Odontaspis ferox off the continental Ecuador. Consequently, the presently reported findings increase the biodiversity of cartilaginous fish off continental Ecuador and expand the range of distribution of the smalltooth sand tiger shark, O. ferox, in Ecuadorian waters and the tropical eastern Pacific Ocean. The first specimen was reported in the artisanal fishing port of Tarqui Beach in Manta, Ecuador, in 2008 and the second individual was registered in the port of Puerto López Canton, Ecuador, in 2009. Each individual was measured to the nearest cm and sexed (Table 1). Photographs of the bodies were taken to show more details of the shark’s morphological characteristics. Identification of both specimens was aided by the following publications: Compagno (1984), Rubio (1988), Fischer et al. (1995), Chirichigno (1998), Robertson and Allen (2015), and Nelson (2006). Two specimens of Odontaspis ferox were registered. The first individual was a juvenile female measuring 121 cm of total length (TL), recorded on 27 November 2008, was landed in the port of Manta, Ecuador (Fig. 1). However, no information is available regarding the catch area or capture method (Fig. 2, Table 1). The second specimen of O. ferox was an adult male, 262 cm TL, captured by fishermen on 23 July 2009 (Fig. 3, Table 1). The specimen was captured at a depth of ~14.6 m, at ~1460 m by using the driftnet method with a mesh size of 12.7 cm. The net was set at night and collected the next morning. The total fishing time was approximately 12 h. Both records were made in the province of Manabí, Ecuador. Fig. 1. Landing sites of smalltooth sand tiger shark, Odontaspis ferox, in Ecuador Table 1 Morphometric characteristics of two specimens of the smalltooth sand tiger shark, Odontaspis ferox, caught off the coast of Ecuador (Measured in cm) Parameter Specimen 1 Specimen 2 Sex Female Male Maturity Juvenile Adult Total length 121 262 Fork length 101.4 225 Precaudal length 87.4 192 Interdorsal length 20 44 Clasper length 19 Specimen 1 was captured on 27 November 2008 and Specimen 2—on 23 July 2009. Odontaspis ferox has been reported off the coast of the Hawaiian Islands, southern California and the Gulf of California (Compagno 1984, Fischer et al. 1995) in North America; Malpelo Island, Colombia (Allen and Robertson 2015); Galapagos Islands, Ecuador (Acuña-Marrero et al. 2013, Ritter and Compagno 2013), and San Ambrosio Island, Chile (Long et al. 2014) in South America. Odontaspis ferox is characterized by its elongated, bulbous snout and large eyes (Fischer et al. 1995). Their dentition includes two or three pairs of lateral cusps, two pairs of symphysial teeth, and three to four intermediate teeth (Compagno 1984, Fischer et al. 1995). All of these characteristics were observed in specimens recorded in Manta and Puerto López Canton, Ecuador (Figs. 2 and 3). Both specimens had two intermediate teeth and four symphysial teeth, each with two pairs of lateral cusps (Fig. 3) and both had large eyes. Also characteristic of Odontaspis ferox are its large dorsal fins. The first dorsal fin is larger than the second. The origin of the second dorsal fin is located near the end of the base of the pelvic fins (Compagno 1984) with a very evident slot at the caudal peduncle (Fischer et al. 1995). Fig. 2. A juvenile female smalltooth sand tiger shark, Odontaspis ferox, landed in Manta, Ecuador; Specimen 1 These distinctive characteristics were identified in the two specimens landed in Manta and Puerto López Canton (Fig. 3). The dorsal fin was situated behind the pectoral fins and the second dorsal fin was smaller than the first. The origin of the second dorsal fin was above the free end of the pelvic fins and near the end of their bases (Fig. 3). The anal fin was smaller in size than the second dorsal fin (Fig. 3). These characteristics confirm that the specimens registered in Manta and Puerto López Canton corresponds to O. ferox, the species described by Risso (1810). Odontaspis ferox has been reported off the coasts of oceanic islands, typically volcanic, suggesting the preferences of O. ferox for oceanic habitats where it can be found at great depths and at times near the surface (Compagno 1984). Surface behaviour in O. ferox has been observed occasionally in Malpelo Island during recreational and scientific diving at a depth range of 15–30 m (Estupiñán-Montaño, personal observation). This behaviour may have led to the capture of the largest specimen (262 cm TL, this study) that was captured by using a driftnet at a depth of 10–15 m. The presence of a small O. ferox specimen (121 cm TL, this study) along with the sighting of two juvenile O. ferox (< 100 cm TL) in Buenaventura port (Colombia) (Estupiñán-Montaño, unpublished data), suggest that individuals that reside these oceanic islands (e.g., Malpelo and Galápagos Islands) may use these locations as nursery areas. However, this hypothesis is yet to be confirmed because there is no available information to support it. Finally, the importance of this study is that it is the first report on the O. ferox species in Ecuadorian fishery and in the continental waters of Ecuador. The study expands the O. ferox range in the tropical eastern Pacific Ocean. Fig. 3. An adult male smalltooth sand tiger shark, Odontaspis ferox, captured in a driftnet and landed in Puerto López Canton, Ecuador; Specimen 2 Acknowledgements We thank the fishermen from the ports of Manta and Puerto López Canton for providing important information regarding the specimen’s capture and permitting us to photograph them. We are also grateful to Vicky Flelitas for her assistance in the field and Anika Mora-Coral for preparing the photographs. FGM thanks the Instituto Politécnico Nacional (IPN; National Polytechnic Institute) for providing fellowships through the Estímulo al Desempeño de los Investigadores (EDI; Performance Incentives) and the Comisión de Operación y Fomento de Actividades Académicas (COFAA; Commission for the Advancement of Academic Activities). References Acuña-Marrero D., Zimmerhackel J.S., Mayorga J., Hearn A. 2013. First record of three shark species, Odontaspis ferox, Mustelus albipinnis and Centrophorus squamosus, from the Galápagos Islands. Marine Biodiversity Records 6: e87. DOI: 10.1017/S1755267213000596 Chirichigno N.F. 1998. Clave para identificar los peces marinos del Perú. Instituto del Mar del Perú, Informe No. 44. 2nd edn. Volumen 3 de Publicacion Especial del Instituto del Mar del Peru, Callao, Peru. Compagno L.J.V. 1984. FAO species catalogue. Sharks of the world: An annotated and illustrated guide of shark species known to date. Hexanchiformes to Lamniformes. Pp. 214–222. FAO Fisheries Synopsis No. 125, Vol. 4, Part 1., FAO, Rome. Fischer W., Krupp F., Schneider W., Sommer C., Carpenter K.E., Niem V.H. 1995. Guía FAO para la identificación de especies para los fines de pesca. Pacífico Centro-Oriental. Vol. 2. Vertebrados, Parte 1. Pp. 647–743. FAO, Rome. Long D.J., Sala E., Ballesteros E., Caselle J.E., Friedlander A.M., Klapfer A., Blum S., Constable H.B. 2014. Summary of South American records of the smalltooth sand tiger shark Odontaspis ferox (Chondrichthyes: Odontaspididae), with the first record from Chilean waters. Marine Biodiversity Records 7: e67. DOI: 10.1017/S1755267214000700 Nelson J.S. 2006. Fishes of the world. 4th edn. John Wiley and Sons, New York, NY, USA. Risso A. 1810. Ichthyologie de Nice, ou histoire naturelle des poisons du Departement des Alpes Maritimes. F. Schoell Paris, France. Ritter E., Compagno L.J.V. 2013. First record of a smalltooth sandtiger shark, Odontaspis ferox, from the Galápagos Islands. Marine Biodiversity Records 6: e130. DOI: 10.1017/S1755267213001115 Robertson D.R., Allen G.R. 2015. Peces costeros del Pacífico Oriental Tropical: Un sistema de información. Instituto Smithsonian de Investigaciones Tropicales. Balboa, Panamá. [CD-ROM]. Rubio R.E. 1988. Peces de importancia comercial para el Pacífico Colombiano. Departamento de Biología. Universidad del Valle, Cali, Colombia. Received: 7 June 2016 Accepted: 19 August 2016 Published electronically: 30 September 2016
View PDF -
Nursery areas for a critically endangered hammerhead shark in the Guatemalan Pacific
Nursery areas for a critically endangered hammerhead shark in the Guatemalan Pacific Julio Sánchez-Jiménez 1 | María de los Rosales-Melgar 1 | Elisa Areano 1 | Ana C. Hernández 1 | Omar Santana-Morales 1 | Juan C. Pérez-Jiménez 1,2 1 Fundación Mundo Azul, Guatemala, Guatemala 2 El Colegio de la Frontera Sur, Campeche, Mexico Correspondence: Juan C. Pérez-Jiménez, El Colegio de la Frontera Sur, CP. 24500, Lerma, Campeche, México. Email: jcperez@ecosur.mx Funding information: Rufford Foundation; PADI Foundation; Waitt Foundation; Shark Conservation Fund; Luis von Ahn Foundation Abstract The scalloped hammerhead (Sphyrna lewini) is the shark most frequently landed in Guatemalan artisanal fisheries. From 2017 to 2023, fishery-dependent monitoring recorded 10,000 individuals across three fishing communities. Neonates represented the largest proportion (n = 5860), followed by young of the year (YOY, n = 3929) and significantly fewer juveniles (n = 183) and adults (n = 28). Seasonal patterns were evident, with neonates (84%) and YOY (67.5%) peaking between May and August. The data suggest that neonates and YOY are prevalent seasonally and annually in the three coastal areas. Keywords artisanal fisheries, fishery management, Guatemala, neonate, nursery habitat, Sphyrna lewini, YOY The scalloped hammerhead, Sphyrna lewini (Griffith & Smith 1834), was recently reassessed as Critically Endangered by the IUCN (Rigby et al., 2019) and listed in CITES Appendix II (CITES, 2019). This species is the most frequently caught shark in Guatemalan Pacific waters, raising significant concerns as neonates and early juveniles have historically been captured in coastal areas (Avalos-Castillo & Santana-Morales, 2021; Ruíz Alvarado & Mijangos López, 1999; Ixquiac Cabrera et al., 2009). Avalos-Castillo and Santana-Morales (2021) observed the persistent presence of early life-history stages from 2017 to 2020, suggesting that these coastal regions may fulfil the criteria Heupel et al. (2007) established for identifying shark nursery areas. Unfortunately, these areas are also important fishing grounds. For instance, artisanal fishing activities in the Guatemalan Pacific occur year-round without restrictions or seasonal closures (Avalos-Castillo & Santana-Morales, 2021), creating challenges for shark conservation. Recognising this issue, the National Plan of Action for Sharks, Rays, and Chimaeras (NPOA-Guatemala; MAGA, 2021) identified the delineation of shark nurseries as a priority research objective to promote their protection. This study aimed to analyse the temporal and spatial occurrences of neonates and young of the year (YOY) scalloped hammerheads along the Guatemalan Pacific coast using fishery-dependent data to identify areas potentially serving as nurseries. Landing records of scalloped hammerheads were collected from three fishing communities along the Guatemalan Pacific coast. Monitoring surveys were conducted from May 2017 to February 2020 by trained biologists from Fundación Mundo Azul (Blue World Foundation), although monitoring in Buena Vista began in 2019. From March 2020 to June 2023, data collection was conducted by biologists and primarily through a Citizen Science programme, with the participation of trained community monitors. In this study, no experiments with animals were performed. Scalloped hammerheads were collected as part of fishery-dependent surveys, therefore all examinations were made on deceased animals captured during commercial fishing operations. Over 1476 days of monitoring, fishery-dependent data were collected from the landings of 52 artisanal boats across the three fishing communities. These boats, made of fibreglass and measuring 7.5–9 m long, were equipped with outboard motors. The fisheries targeted teleost fish and rays using bottom and midwater monofilament gillnets (mesh sizes 4–6 cm) or bottom longlines with J or Eagle Claw half circle hooks (3–6 cm in size). Scalloped hammerheads were measured to the nearest centimetre using total length (LT), defined as the horizontal distance from the tip of the snout to the tip of the caudal fin in its natural position (Compagno, 1984). Sex was determined macroscopically according to the presence or absence of claspers on the pelvic fins. Sharks were categorised into four life stages: (1) neonates (Ne), identified by the presence of an unhealed or healing umbilical scar (Castro, 1993); (2) young of the year (YOY), characterised by a healed umbilical scar and classified as individuals within their first year of life based on the von Bertalanffy growth curve by Piercy et al. (2007); (3) juvenile (J) sharks older than a year but not yet sexually mature; and (4) adults (A) in males when claspers were fully calcified (Clark & Schmidt, 1965), and females considered mature if pregnant or, if not pregnant, measuring over 245 cm TL (Castro, 2011). FIGURE 1 Proportions of early life history stages of scalloped hammerhead (Sphyrna lewini) recorded during the landing monitoring programme from 2017 to 2023 in the fishing communities of Buena Vista, Las Lisas and Sipacate on the Pacific coast of Guatemala. (a) Overall percentage distribution of neonates (Ne), young of the year (YOY), and combined juveniles and adults (J-A) across fishing communities. (b) Monthly percentage distribution of neonates across fishing communities. (c) Monthly percentage distribution of young of the year (YOY) across fishing communities. The total number of recorded specimens is shown next to each community’s name. TABLE 1 Annual records of neonates and young of the year scalloped hammerheads (Sphyrna lewini) from the landing monitoring programme in the fishing communities of Buena Vista, Las Lisas and Sipacate on the Pacific coast of Guatemala. 2017 2018 2019 2020 2021 2022 2023 Total Neonates Buena Vista 93 13 94 347 292 839 Las Lisas 122 46 103 339 207 67 91 975 Sipacate 36 71 332 1887 449 659 612 4046 Total 158 117 528 2239 750 1073 995 5860 Young of the year Buena Vista 50 40 437 129 656 Las Lisas 22 18 7 82 52 69 22 272 Sipacate 44 43 159 1718 265 448 324 3001 Total 66 61 216 1800 357 954 475 3920 A total of 10,000 scalloped hammerheads were recorded across the three fishing communities. Neonates were the most frequently observed life stage (n = 5860), followed by YOY (n = 3929), with juveniles (n = 183) and adults (n = 28) representing a small fraction of the total. Neonates and YOY collectively accounted for over 96% of all records across the communities (Figure 1a). The size range and mean in cm LT (mean ± standard deviation) for each stage were as follows: neonates ranged from 33.0 to 54.4 (50.2 ± 2.8), YOY ranged from 54.1 to 87.0 (62.9 ± 7.9), juveniles ranged from 87.3 to 144.0 (94.6 ± 7.9) and adults ranged from 179.0 to 284.0 (247.7 ± 27.5). Neonates and YOY were recorded in all years across the three fishing communities, except for 2017 and 2018 in Buena Vista, where monitoring efforts were absent. The majority of neonate and YOY records were obtained between 2020 and 2023, with 5057 neonates (86.3%) and 3586 YOY (91.3%) (Table 1). This significant increase is attributed to the intensified monitoring efforts implemented through the Citizen Science programme. The highest percentage of monthly neonate records was observed between May and August (Figure 1b), while YOY records peaked between June and September (Figure 1c). In April–June, neonates represented 84.1% and YOY 67.5% of their total annual records. Specifically, during this period neonate records accounted for over 77% of the total neonate records in all three communities: Buena Vista (77.8%), Las Lisas (81.4%) and Sipacate (85.9%). Similarly, in the same period, YOY records comprised more than 52% of the total YOY records for each community: Buena Vista (59.9%), Las Lisas (52.9%) and Sipacate (70.5%). In July–September, YOY records were distributed as follows: 34.6% in Buena Vista, 37.5% in Las Lisas and 24.8% in Sipacate. The data indicate that neonates and YOY are consistently present both seasonally and annually across the three coastal areas, aligning with the criteria established by Heupel et al. (2007). The present study used fishery-dependent data collected through a Citizen Science programme to analyse the temporal patterns of the early-stage scalloped hammerhead sharks. While Heupel et al. (2007) emphasised the importance of using fishery-independent data to effectively identify nursery habitats, such data with sufficient temporal and spatial coverage are often lacking (Froeschke et al., 2010), particularly in regions like the Guatemalan Pacific. One of the advantages of utilising a Citizen Science programme is the broad coverage of fishing effort, enabling the analysis of seasonal and annual catch records across multiple fishing communities. Also, the findings confirm that, as shown by Oñate-González et al. (2017) and Cuevas-Gómez et al. (2020), fishery-dependent monitoring can effectively provide data to identify nursery areas in coastal regions where fishery-independent data are limited or unavailable. The findings indicated a tendency for higher numbers of neonates and YOY to be recorded in Sipacate. Located on the central coast of Guatemala, Sipacate is approximately 43 km from Buena Vista and 97 km from Las Lisas. While the general characteristics of the three studied coastal areas are similar, with shallow, turbid waters and slightly uneven mud and sand bottoms (Brenes et al., 1993; Ixquiac Cabrera et al., 2009), Sipacate stands out for its broader shallow habitat. The 20- and 50-m isobaths are farther from the shore at Sipacate compared to Buena Vista and Las Lisas. This greater habitat amplitude is significant, as nursery areas typically occur at depths of 10–50 m, with a preference for 20 m depths (Ixquiac Cabrera et al., 2009). Additionally, the coastal area between Buena Vista and Las Lisas is narrower and features a deep canyon that drops to over 500 m. Guatemala published the National Plan of Action for Sharks, Rays and Chimaeras (NPOA-Guatemala) in 2008, recently updated in 2021 (MAGA, 2021). Among its priority research topics, the NPOA emphasizes identifying nursery areas as a critical step for implementing effective protection measures. Defining these areas is essential, particularly for supporting the establishment of fish replenishment zones (FRZ), such as in the coastal region of Las Lisas (Mojica et al., 2021). This study underscores the need for each community to establish its own FRZ to protect the early life stages of the scalloped hammerhead. Protecting these nurseries is crucial, as Elizondo-Sancho et al. (2022) demonstrated limited gene flow between nursery areas in Guatemala, Costa Rica and Panama, with the species exhibiting reproductive philopatry, resulting in genetically independent units. Author contributions Julio Sánchez-Jiménez, Ana C. Hernández and Omar Santana-Morales: Conceptualisation, methodology, data collection, writing – review and editing, visualisation. María de los Rosales-Melgar and Elisa Areano: Funding acquisition, project administration, supervision, writing – review and editing. Juan C. Pérez-Jiménez: Conceptualisation, formal analysis, investigation, writing – original draft, writing – review and editing, visualisation. Acknowledgements We thank the fishers of the artisanal fleet from Buena Vista, Las Lisas and Sipacate. Special thanks to Fidel Hernández, Yessica Hernández, Edwin Segovia, Manuel Zelada, Hugo Martínez and Franklin Léon for their participation in the Citizen Science programme. Funding information Funding was provided by the Rufford Foundation, the PADI Foundation, the Waitt Foundation, the Shark Conservation Fund and the Luis von Ahn Foundation. ORCID Julio Sánchez-Jiménez https://orcid.org/0000-0002-7258-1700 References Avalos-Castillo, C. G., & Santana-Morales, O. (2021). Characterization of the artisanal elasmobranch fisheries off the Pacific coast of Guatemala. Fishery Bulletin, 119, 3–9. https://doi.or
View PDF -
Elasmobranch bycatch of the shrimp trawl fishery along the Pacific coast of Guatemala
Elasmobranch bycatch of the shrimp trawl fishery along the Pacific coast of Guatemala Julio Sánchez (contact author) 1 | Omar Santana Morales 1,2 | Rebeca Zertuche 2 | Elisa Areano 1 Email address for contact author: jfsanchez89@gmail.com 1 Fundación Mundo Azul, Boulevard Rafael Landívar 10-05 Paseo Cayalá zona 16, Edificio D1, Oficina 202, 01016 Guatemala City, Guatemala 2 Ecología Cielo, Mar y Tierra A.C., Avenida del Puerto 2270, Colonia Hidalgo, 22880 Ensenada, Baja California, Mexico Abstract In this study, the species composition of bycatch in the shrimp bottom-trawl fishery off the Pacific coast of Guatemala was examined. In total, 15 species of elasmobranchs, including 13 ray species and 2 shark species, were recorded. Of these taxa, 1 species is listed as critically endangered, 4 species are listed as near threatened, 7 species are listed as vulnerable, and 1 species is listed as a species of least concern by the International Union for Conservation of Nature. Currently, there is no official monitoring system for shrimp trawling in Guatemala; therefore, the abundance and biological characteristics of the elasmobranch species caught as bycatch are unknown. This information is lacking because only 5.5% of the registered elasmobranch bycatch was landed and traded for its economic value. Manuscript submitted 15 December 2022. Manuscript accepted 25 April 2023. Fish. Bull. 121:78–83 (2023). Online publication date: 25 May 2023. doi: 10.7755/FB.121.3.2 The views and opinions expressed or implied in this article are those of the author (or authors) and do not necessarily reflect the position of the National Marine Fisheries Service, NOAA. Worldwide, shrimp trawling has the highest discard rate of all fisheries (27% in 2005) (Kelleher, 2005). Although reducing bycatch is important from both economic and management standpoints, bycatch is economically valuable in developing countries and supports food security in many coastal communities (Gillett, 2010; Barreto et al., 2022). Nonetheless, in many Latin American countries, shrimp trawl fisheries are currently banned because they are unsustainable (TNC 1 ). In Guatemala, cartilaginous and bony fish species are incidentally caught in the shrimp trawl fishery, which is still permitted. The species that are commercially valuable are retained, and the others are discarded at sea. Shrimp trawling for 5 shrimp species and 1 prawn species is conducted on both the Pacific and Caribbean coasts of Guatemala (TNC 1 ). In the 1980s and into the mid-1990s, 60 large vessels and about 1500 artisanal vessels participated in this fishery. Between 1995 and 2000, a notable reduction in catch occurred and has continued to the present day. From 2010 through 2013, 750–1500 metric tons (t) of shrimp (plus 250 t of bycatch species) were landed, but only 150 t of shrimp were landed from 2014 through 2016. In 2016, bycatch (100 t) was greater than the catch of shrimp (50 t) (FAO, 2018). Ixquiac Cabrera (1998) identified 148 species of bony fish and 11 species of elasmobranchs among the shrimp bycatch from the Pacific coast of Guatemala, although the study did not include a complete annual fishing cycle or information on the biological characteristics of incidentally caught elasmobranchs. Using data from both the artisanal and trawl fisheries operating on the continental shelf, Ixquiac Cabrera et al. 2 constructed a catalog of batoid species present in the Pacific Ocean off Guatemala and reported 15 species from the families Dasyatidae, Myliobatidae, Urotrygonidae, Rajidae, Rhinobatidae, and Narcinidae. Nonetheless, a notable information gap exists regarding the bycatch of the shrimp trawl fishery. In an effort to fill this gap, we developed a method to evaluate the bycatch of different shrimp trawlers. Some vessels systematically and voluntarily provided samples of their bycatch from each fishing trip so that the composition of the bycatch could be characterized. Through the results of this study, we provide herein a current description of the shrimp trawl fishery in Guatemala and characterize the species composition and biological characteristics of incidentally caught elasmobranchs. These data will aid in managing these species. Materials and methods Study area Bottom trawling is conducted along the Pacific coast of Guatemala within the exclusive economic zone (83,000 km²) between the 5- and 50-m isobaths (<30 km offshore) (TNC 1 ). The low-temperature months are from January through March (28.6–29.1°C), and the high-temperature months are from April through December (29.2–30.2°C) (Ponce Hernández, 2015). Therefore, the temperature of the sea surface in this region is quite stable throughout the year. The Directorate of Fisheries and Aquaculture Regulations (DIPESCA) of Guatemala conducts official inspections at the industrial landing sites of Puerto San José and Buena Vista. However, many trawlers and small vessels strategically use the alternative artisanal landing zone of Las Lisas, which is located approximately 150 km from the industrial landing sites and has its own fish market. During the rainy season (May–October) when catches are high, fishermen are paid the best prices at Las Lisas. Monitoring of landings Crew members of the vessels included in this study voluntarily collected and retained a portion of the organisms that are normally discarded at sea from each fishing trip. We then collected these retained organisms and used them to obtain biological data. Landings from 69 different fishing trips and 8 different trawl vessels were documented in Las Lisas from 2017 through 2022, and portions of elasmobranchs retained from the catches were sampled and photographed. Total length (for sharks, the natural extension of the caudal fin was used), disc width, disc length, and clasper length (in males) were recorded (to the nearest 0.5 cm). The maturity of males was verified by using clasper calcification. Eggs or embryos emerging from the cloaca in females were opportunistically recorded. In addition, trawler crews gathered the elasmobranchs that were to be discarded and collected one sample (5–7 kg) per trip. Each discard specimen was photographed, measured, and identified following Compagno (2001), Ebert and Fowler (2015), and Ebert et al. (2021). For all species, we summarized the main morphological characteristics, sex ratio, and size at first maturity obtained from the literature (Villavicencio Garyzar, 2000; Anislado-Tolentino and Robinson-Mendoza, 2001; López et al. 3 ; Payán et al., 2011; Torres-Huerta 4 ; Castellanos Betancourt et al., 2013; Pincay-Espinoza and Romero-Calcedo, 2014; Torres Palacios, 2015; Vélez Tacuri, 2015; Carrera-Fernández et al., 2019; Ronquillo Moreira, 2019; Jiménez García, 2020), along with conservation status according to the International Union for Conservation of Nature (IUCN) Red List of Threatened Species (IUCN, 2022). Finally, length-frequency histograms were created for species for which data for more than 30 individuals were collected. Results and discussion Fishing activity Five shrimp species, the seabob (Xiphopenaeus kroyeri), crystal shrimp (Penaeus brevirostris), yellowleg shrimp (P. californiensis), whiteleg shrimp (P. vannamei), and blue shrimp (P. stylirostris), and 1 prawn species, the pelagic red crab (Pleuroncodes planipes), are harvested along the Pacific coast of Guatemala (TNC 1 ). Bony fish species, such as the bigmouth sanddab (Citharichthys gilberti), spotted rose snapper (Lutjanus guttatus), and Pacific sierra (Scomberomorus sierra) (Jolon-Morales et al. 5 ), and shark species, such as the scalloped hammerhead (Sphyrna lewini) (FUNMZ 6 ), are also caught, landed, and marketed. From 2017 through 2022, 16 active shrimp trawlers, with an average of 5 crew members, average length of 18.66 m (13.00–22.87 m), average net registered weight of 22.37 t [4–87 t], and average gross registered weight of 70.49 t (14–170 t), operated in the region (Morales 7 ). There are no closed seasons to regulate commercial shrimp fishing; as a result, trawling is conducted year-round, although shrimp trawlers are more active during the rainy season (FUNCAGUA 8 ). The shrimp trawling fleet requires 30-d permits granted by DIPESCA. Normally, trawling vessels work for 12–15 d at a time, and 4–5 trawl tows are conducted each day (3–4 h of operation in total per day). We observed that trawlers, preferring to reduce fuel costs, made partial landings in Las Lisas with the aid of smaller boats from the fishing community instead of returning to the official docks of Puerto San José and Buena Vista. A limited number of trained DIPESCA personnel are available to conduct inspections and collect data of commercial shrimp landings to control fishing activities along the Pacific coast of Guatemala; therefore, data are limited and unreliable. High staff turnover within DIPESCA has also resulted in unreported or irregularly reported catches and unreliable data. No monitoring programs currently record the additional organisms captured as bycatch in shrimp trawling activities. Information on bycatch off Guatemala is lacking, although turtles and marine mammals, in addition to elasmobranchs, are known to be captured with shrimp trawling fishing gears. Landings In all, 43 trips (62.3% of trips) were conducted during the rainy season, and 26 trips (37.7% of trips) were conducted during the dry season. A total of 1330 elasmobranchs were recorded, belonging to 5 orders, 12 families, and 15 species. Of these 15 species, 1 species is listed as critically endangered, 4 species are listed as near threatened, 7 species are listed as vulnerable, and 1 species is listed as a species of least concern on the IUCN Red List (Table 1) (IUCN, 2022). Overall, 73 elasmobranch individuals (5.5% of the total number of elasmobranchs recorded) were considered commercially valuable and sold. The bycatch mainly comprised 3 ray species, the longtail stingray (Hypanus longus), golden cownose ray (Rhinoptera steindachneri), and Pacific eagle ray (Aetobatus laticeps), and 2 shark species, the scalloped hammerhead and bull shark (Carcharhinus leucas). The fins of large sharks (>1 m in total length) were dried and marketed. Ten elasmobranch species were discarded (number of samples [n]=1257, 94.5% of the total number of individuals recorded; Table 1). Of these 10 species, the vermiculate electric ray (Narcine vermiculata) (n=426) was the most abundant, followed by the Panamic stingray (Urotrygon aspidura) (n=397), whitesnout guitarfish (Pseudobatos leucorhynchus) (n=182), giant electric ray (N. entemedor) (n=127), blotched stingray (U. chilensis) (n=72), and longtail stingray (n=38). Other species were represented by less than 30 individuals (Table 1). Table 1. Number of samples (n), ratio of males (M) to females (F), size range, and status on the International Union for Conservation of Nature and Natural Resources (IUCN) Red List of Threatened Species for elasmobranch species landed by shrimp trawlers in Las Lisas, Guatemala, during 2017–2022. Also noted is whether captured individuals of non-target species were traded in the market (bycatch) or had no commercial value and were returned to the sea dead or alive (discard). The measurement of size (MS) is either total length (TL) or disk width (DW). Sizes at first maturity are from the literature. No data (ND) on size at maturity were available in the literature for Rostroraja equatorialis. Species n Sex ratio (M:F) MS Average size (cm) Size range (cm) Size at first maturity (cm) – Males Size at first maturity (cm) – Females IUCN status Discard or bycatch Narcine vermiculata 426 151:275 TL 20.6 6.0–39.3 11.6 11.6 Least concern Discard Urotrygon aspidura 397 153:244 TL 32.9 9.0–94.2 23.0 25.0 Near threatened Discard Pseudobatos leucorhynchus 182 58:124 TL 38.2 18.0–63.4 51.2 48.5 Vulnerable Discard Narcine entemedor 127 34:93 TL 27.4 14.0–68 47.7 70.0 Vulnerable Discard Urotrygon chilensis 72 30:42 DW 18.3 10.0–29
View PDF -
First record of the bluntnose sixgill shark Hexanchus griseus (Bonnaterre, 1788) in the Guatemalan Caribbean Sea
First record of the bluntnose sixgill shark Hexanchus griseus (Bonnaterre, 1788) in the Guatemalan Caribbean Sea Julio Sánchez-Jiménez 1 , Omar Santana-Morales 1 , Josué Ayala-Donado 1 , María de los Rosales-Melgar 1 , Elisa M. Areano-Barillas 1 , Mónica González-Jaramillo 2 & Juan Carlos Pérez-Jiménez 1,3 Corresponding author: Juan Carlos Pérez-Jiménez (jcperez@ecosur.mx) Abstract The Guatemalan Caribbean has a deepwater fishing area close to the shore around the Cayman Trench. This study reports the first record of the bluntnose sixgill shark (Hexanchus griseus) from this fishing area. Fishery-independent surveys using longlines at ~430-465 m depth, ~11 km northeast of El Quetzalito fishing village, were conducted in 2022 and 2023. Two bluntnose sixgill sharks were captured during these surveys. The sharks were females with total lengths of 300 and 310 cm, with morphological characteristics consistent with this species. These are the first confirmed records of bluntnose sixgill sharks in the western Caribbean Sea. Expanding coastal fisheries to deeper waters presents an emerging threat to deep-sea chondrichthyans in the region. Therefore, periodic fisheries monitoring is needed to estimate their vulnerability to fishing pressure. Keywords Hexanchus griseus; sixgill shark; Hexanchidae biodiversity; deep-water; Cayman Trench; Guatemala conservation The bluntnose sixgill shark Hexanchus griseus (Bonaterre, 1788) is a large species (at least 482 cm total length, TL) with a patchy distribution worldwide that inhabits continental and insular shelves from the surface to at least 2500 m depth in temperate and tropical waters of the Pacific, Atlantic, and Indian oceans (Compagno 1984, Ebert et al. 2021). Castro (2011) reported that ecology and life history differences exist between the Atlantic and Pacific forms, now explained by Vella & Vella (2017) as the result of population structure. Besides population subdivisions between the Pacific and Atlantic oceans, there are subdivisions within oceans and even on a smaller scale within the Mediterranean Sea (Vella & Vella 2017), highlighting the need for adequate knowledge of its distribution at a finer scale. Despite being recorded in the southwestern Caribbean Sea, in Colombia (Mejía-Falla & Navia 2019) and Venezuela (Ehemann et al. 2019, Tavares 2019), its presence was still unconfirmed in the western Caribbean. The bluntnose sixgill shark was globally assessed in 2019 as Near Threatened (NT) on the IUCN Red List of Threatened Species because it is estimated to have undergone a population reduction of 20-29% over the past three generations (160 years) (Finucci et al. 2020). Although the species is infrequently caught incidentally in deepwater fisheries across its range, there is a high overlap between its distribution and intensive fishing pressure, and there is a lack of species-specific management across its entire range (Finucci et al. 2020). This situation highlights the need for information about distribution at a finer scale to assess potential fisheries impacts or other threats on its populations. Two sixgill sharks of the order Hexanchiformes, family Hexanchidae, were caught through fishery-independent surveys using an artisanal fishing vessel (7.62 m long with outboard motor) from El Quetzalito, Guatemala, in September 2022 and April 2023. Sampling was conducted through permit Bno.1048, issued by Consejo Nacional de Áreas Protegidas (CONAP), as a part of a project to generate a baseline of elasmobranch deepwater fisheries. The sharks were caught at ~430-465 m depth with a longline using ten circle hooks N°18, baited with tarpon Megalops atlanticus Valenciennes, 1847 and black jack Caranx lugubris Poey, 1860, and a chemical light stick near the baited hook to increase shark attraction, in a fishing area called El Hoyo (15°51’6.60”N, 88°14’33.78”W). The area is located ~11 km northeast of El Quetzalito fishing village on the margin of the Cayman Trench. The specimens were released after being sexed, and the total length was measured with a metric tape. Both sharks were identified following Compagno (1984) and Ebert et al. (2021). The first bluntnose sixgill shark, a 310 cm TL female (Fig. 1), was caught and released on September 12, 2022, and the second, a 300 cm TL female, was caught and released on April 21, 2023. Both females were presumed to be immature since size-at-maturity is >400 cm TL (Castro 2011, Ebert et al. 2021). Figure 1. Bluntnose sixgill shark (Hexanchus griseus), a 310 cm TL female caught and released on September 12, 2022, in the fishing area of El Hoyo, Guatemalan Caribbean. The dotted circle highlights the six pairs of gill slits. Visual observation of the specimen revealed key diagnostic characteristics consistent with hexanchid sharks. The individuals had six pairs of gill slits, a large mouth, one spineless dorsal fin behind the pelvic fins, a short lower lobe of the caudal fin, and an anal fin. More specifically, both sharks had key characteristics of the bluntnose sixgill shark, including a large, heavy body; broad head; small eyes; and grey or tan to blackish color in the dorsal area. Another sixgill shark present in the study area is the Atlantic bigeye sixgill shark, Hexanchus vitulus (Springer & Waller 1969), which can be distinguished from the bluntnose sixgill shark by its slender, medium-sized body (maximum size of 178 cm TL), a broadly acute mouth; and relatively large eyes (Ebert et al. 2021). Although Finucci et al. (2020) and Ebert et al. (2021) include other Central American countries (Honduras, Nicaragua, Costa Rica, and Panama) in the species distribution map, occurrence in these countries has yet to be confirmed. Further, only some confirmed records of bluntnose sixgill sharks from the western Atlantic are found in the literature. Bigelow & Schroeder (1948) reported it from the northern coast of Cuba and established that it was rare northwards; for example, there was only one record of a specimen from North Carolina, USA. Bigelow & Schroeder (1948) also established no evidence of occurrence anywhere in the Gulf of Mexico and the Caribbean region. Later, Gilhen & Coad (1991) reported its presence in Nova Scotia, Canada, and Carey & Clark (1995) in Bermuda. Castro (2011) confirmed that the first record in the western North Atlantic was a specimen (310 cm TL) caught in North Carolina (in 1886) and that there was another record (396 cm TL) from the Mississippi River delta, northern Gulf of Mexico (in 1963); additional specimens have been reported from Cape Hatteras, New England, Texas, Florida (Castro 2011), Maryland, Louisiana, Alabama, New Jersey, and Bahamas (Table 1). Table 1. Records of the bluntnose sixgill shark (Hexanchus griseus) deposited in ichthyological collections from the western Atlantic. Ichthyological collection Catalog number Country Site of collection Depth (m) Year USNM 37790 USA North Carolina 1886 ANSP Fish 102597 Cuba Havana 1934 USNM 111180 USA Maryland 1942 USNM 112600 Bahamas Bimini 274 1948 UF Fish 102424 USA Louisiana 0 1962 USNM 188048 USA Louisiana 357-366 1962 UF Fish 101285 USA Florida 180 1966 TCWC 3923.01 USA Texas 1984 UF Fish 179524 USA South Carolina 1987 UF Fish 178570 Bahamas Abaco Island 152 1988 UF Fish 178571 Bahamas Abaco Island 152 1988 CMN 1990-0032.1 Canada Nova Scotia 1989 UF Fish 48458 USA Alabama 0 1990 UF Fish 83993 USA Alabama 0 1990 UF Fish 171140 USA New Jersey 2007 MCZ 36217 Cuba Havana No data MCZ 40424 Bahamas Bimini 304 No data MCZ 35630 Cuba Havana No data NCSM 28450 USA No data In the Caribbean Sea, as mentioned above, the species has been reported in Colombia (Mejía-Falla & Navia 2019) and Venezuela (Ehemann et al. 2019, Tavares 2019). The bluntnose sixgill shark has been recorded in the southwest Atlantic (Coscarella et al. 1997, Sabadin et al. 2020, Santander-Neto et al. 2023), particularly in northeast Brazil where Santander-Neto et al. (2023) reports 23 specimens (mainly immature females 180-300 cm TL) caught by commercial fisheries. Thus, before the present study, the reports from Cuba, Colombia, and Venezuela were the only verified records from the Caribbean Sea. Two other species of the family Hexanchidae have recently been documented for the first time in the small-scale fisheries in the same fishing area where the bluntnose sixgill sharks were caught. Hacohen-Domené et al. (2017) documented two female (28 and 37 cm TL) sharpnose sevengill sharks, Heptranchias perlo, captured in 2016. Avalos-Castillo et al. (2020) reported 10 (61-165 cm TL) Atlantic bigeye sixgill sharks, H. vitulus, caught between 2015-2019. In the Caribbean Sea, the sharpnose sevengill shark and the Atlantic bigeye sixgill shark have also been recorded in Colombia (Mejía-Falla & Navia 2019), Jamaica (McLaughlin & Morrissey 2004), and Venezuela (Ehemann et al. 2019, Tavares 2019), and additionally, the Atlantic bigeye sixgill shark in the Bahamas (Springer & Waller 1969) and Belize (Daly-Engel et al. 2019). Mejía-Falla & Navia (2019) reported the bigeye sixgill shark Hexanchus nakamurai in Colombia; however, the species name H. vitulus was recently resurrected, with bigeye sixgill sharks from the Atlantic referrable to H. vitulus, and those from the Indo-Pacific as H. nakamurai (Ebert et al. 2021). The presence of the Cayman Trench near the Guatemalan Caribbean coast may explain the occurrence of deepwater chondrichthyans in the study area (Hacohen-Domené et al. 2016, Polanco-Vásquez et al. 2017, 2022, Avalos-Castillo et al. 2020). The Cayman Trench extends from the Gulf of Honduras, to which the Guatemalan Caribbean coast belongs, to southeast Cuba. It has the deepest zones of the entire Caribbean (with regions deeper than 6000 m) and is bounded on the north and south sides by steep slopes (Donnelly 1994). The few reports of bluntnose sixgill sharks in the Caribbean Sea reflect low encounter rates with fisheries. Periodic monitoring of fisheries is needed to estimate their vulnerability to fishing pressure due to the expansion of coastal fisheries to deeper waters, which presents an emerging threat to deepwater elasmobranch assemblages (Baremore et al. 2021, Talwar et al. 2022). Therefore, it is critical to provide data on distribution and basic biological aspects to assess vulnerability to overexploitation and inform regional management measures. Acknowledgments Fundación Mundo Azul thanks El Quetzalito’s fishers for their support while conducting fishery-independent surveys, and Consejo Nacional de Áreas Protegidas (CONAP) and Dirección de la Normatividad de la Pesca y la Acuacultura (DIPESCA) for permitting this research. Rufford Foundation, Luis von Ahn Foundation, and The Summit Foundation funded the elasmobranch monitoring project. All research activities were conducted under permit Bno.1048, issued by Consejo Nacional de Áreas Protegidas (CONAP). Additional photographic and video material is available on request. References Avalos-Castillo, C.G., Santana-Morales, O., Becerril-García, E.E. & Areano, E. 2020. New records and morphometry of the Atlantic sixgill shark Hexanchus vitulus in the Caribbean coast of Guatemala. Latin American Journal of Aquatic Research, 48: 488-491. doi: 10.3856/vol48-issue3-fulltext-2436 Baremore, I.E., Graham, R.T. & Matthew, J.W. 2021. Fishing down the reef slope: Characteristics of the nearshore deepwater fisheries of Mesoamerica. Ocean and Coastal Management, 211: 105773. doi: 10.1016/j.ocecoaman.2021.105773 Bigelow, H.B. & Schroeder, W.C. 1948. Fishes of the western North Atlantic, lancelets, cyclostomes, and sharks. Memoir N°1. Sears Foundation for Marine Research, Yale University, New Haven. Carey, F.G. & Clark, E. 1995. Depth telemetry from the sixgill shark, Hexanchus griseus, at Bermuda. Environmental Biology of Fishes, 42: 7-14. doi: 10.1007/BF00002345 Castro, J.I. 2011. The sharks of North America. Oxford University Press, Oxford. Compagno, L.J.V. 1984. Sharks of the world. An annotated and illustrated ca
View PDF -
First record of the kitefin shark, Dalatias licha (Bonnaterre, 1788) from the Guatemalan Caribbean Sea
First record of the kitefin shark, Dalatias licha (Bonnaterre, 1788) from the Guatemalan Caribbean Sea Julio Sánchez-Jiménez 1 , Josué Ayala-Donado 1 , María de los Ángeles Rosales Melgar 1 , Elisa M. Areano-Barillas 1 , Devanshi Kasana 2 , Mónica González-Jaramillo 3 & Juan Carlos Pérez-Jiménez 1,4 1 Fundación Mundo Azul, Guatemala, Guatemala 2 Department of Biological Sciences, Florida International University, North Miami, FL, USA 3 Independent Consultant, San Francisco de Campeche, Campeche, Mexico 4 El Colegio de la Frontera Sur, Ciudad Industrial, Lerma, Campeche, Mexico Corresponding author: Juan Carlos Pérez-Jiménez (jcperez@ecosur.mx) Associate Editor: Yassir Torres Abstract Deepwater fishing operations occur close to the shore of the Guatemalan Caribbean. In a study to characterize the deepwater species present in the fishing area, the incidental catch of a kitefin shark, Dalatias licha, was recorded at a depth of ~284-334 m, ca. 11 km northeast of El Quetzalito fishing village. The adult female with a total length of 1420 mm had morphological characteristics consistent with D. licha, which was confirmed by molecular methods. First record of D. licha in the western Caribbean region, a species cataloged at risk by the IUCN red list. With this record, the number of shark species known in the Guatemalan Caribbean increases to 25. Keywords Chondrichthyes; Dalatiidae; Dalatias licha; by-catch; deep-water; Cayman Trench; Guatemala The kitefin shark (Dalatias licha) (Bonnaterre, 1788) is a medium-sized (1820 mm maximum total length, TL) deepwater, mesopelagic to benthic species encountered in warm, temperate, and tropical waters of the outer continental and insular shelves and slopes from 37 to 1800 m depth (Compagno 1984). However, it is most commonly recorded at depths between 300 to 1000 m (Castro 2011). The species occurs circumglobally with patchy distributions in the Atlantic and Indo-West Central Pacific oceans (Finucci et al. 2018), reportedly forming distinct regional subpopulations (Compagno & Cook 2005). D. licha is a target and incidental catch across its range for the flesh, squalene-rich liver oil, fishmeal, and leather (Compagno 2016). However, life history characteristics of D. licha, such as slow growth and relatively large size at maturity of 1000-1200 mm TL (Walls & Guallart 2015, Ebert et al. 2021), render it particularly vulnerable to exploitation and rapid depletion, as evidenced by declines in targeted fisheries in Australia and the northeast Atlantic (Walls & Guallart 2015, Finucci et al. 2018). Due to significant population declines documented in regional subpopulations, the species was globally assessed as Vulnerable by the International Union for the Conservation of Nature Red List with an inferred global population decline of at least 30% (Finucci et al. 2018). The recorded specimen of D. licha measured 1420 mm TL and weighed 13.6 kg. The shark was caught by an artisanal fishing vessel (7.62 m long and outboard motor) on January 10, 2023, using a longline (100 circle hooks #18, baited with tarpon and mullet) in a fishing area called "El Hoyo" at ~284-334 m depth. The area is located 11 km northeast of El Quetzalito, Guatemala, on the margin of the Cayman Trench. The taxonomic identification of the specimen was done following Ebert et al. (2021). Eighty-two measurements were taken (Table 1) following Compagno (1984) for its description. The caught individual had dark brown coloration, short nose, thick lips, large spiracles, no anal fin, and triangular lower teeth with serrations (Fig. 1). The specimen was deposited at the Centro de Estudios del Mar y Acuicultura (CEMA) collection of the Universidad de San Carlos de Guatemala (USAC) under reference number 166. Molecular analysis was conducted to confirm species identification. Tissue samples were collected and preserved in 95% ethanol. Genomic DNA was extracted for the samples using the manufacturer’s tissue protocol for the Qiagen DNAeasy kit (Qiagen, Valencia, California). DNA barcoding to amplify the highly conserved mitochondrial cytochrome oxidase I gene (COI) was used following the protocol outlined by Cardeñosa et al. (2014). Partial COI sequences (~450-600 bp) were amplified using the universal primers FishCoxI F (5′ TCWACCAACCACAAGAYATYGGCAC 3′) and FishCoxI R (5′ TARACTTCWGGGTGRCCRAAGAATCA 3′) modified from Ward et al. (2005). The polymerase chain reaction (PCR) profile was as follows: 94°C for 2 min followed by 35 cycles of 94°C for 30 s, 55°C for 45 s, and 72°C for 40 s, with a final extension of 72°C for 10 min. A no-template negative control was included to monitor for reagent contamination. PCR products were visualized on 2% agarose gel, purified using Exo-SAP, and sequenced on an ABI3730 DNA Analyzer (Thermo Fisher Scientific). The sequences were cleaned and edited using Geneious 2023.2.1 (http://www.geneious.com). Trimmed sequences were used as query searches for BLAST of National Center for Biotechnology (NCBI) GenBank (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and Barcode of Life Data Systems (http://www.boldsystems.org), assigning species identity with a >99% sequence similarity to D. licha. A fragment of 567 bp of the COI gene was obtained for the sample (E-value = 0.0). The sequence was submitted to GenBank under accession number OQ591896. The literature has limited information about this species’ regional distribution, fisheries, ecology, and biology from the western Atlantic. In the western Atlantic, the species was first reported in the Gulf of Maine, north Atlantic Ocean (Bigelow & Schroeder 1948), followed by Oregon in the northern Gulf of Mexico (Bigelow et al. 1955). Subsequently, there were photographic records in Bermuda and Grand Cayman (Clark & Kristof 1990), and more recently, this species has been reported from the south Atlantic in Brazil (Soto & Mincarone 2001) and the southern Caribbean Sea in Venezuela (Tagliafico et al. 2007) (Table S1). Table 1. Morphometric measurements of Dalatias licha from the Caribbean Sea of Guatemala. Measurement Measurements (mm) % of total length Total length 1420 Precaudal length 1140 80.28 Pre-second dorsal length 975 68.66 Pre-first dorsal length 505 35.56 Head length 280 19.71 Prebranchial length 215 15.14 Prespiracular length 120 8.45 Preorbital length 90 6.33 Prepectoral length 280 19.71 Prepelvic length 835 58.80 Snout-vent length 920 64.78 Interdorsal space 340 23.94 Dorsal-caudal space 135 9.50 Pectoral-pelvic space 405 28.52 Pelvic-caudal space 170 11.97 Vent-caudal length 500 35.21 Prenarial length 35 2.46 Preoral length 62 4.36 Eye length 55 3.87 Eye height 25 1.76 Intergill length 70 4.92 First-gill slit height 30 2.11 Second-gill slit height 30 2.11 Third-gill slit height 32 2.25 Fourth-gill slit height 32 2.25 Fifth-gill slit height 37 2.60 Pectoral anterior margin 135 9.50 Pectoral radial length 155 10.91 Pectoral base 80 5.63 Pectoral inner margin 70 4.92 Pectoral posterior margin 90 6.33 Pectoral height 150 10.56 Pectoral length 125 8.80 Dorsal caudal margin 281 19.78 Preventral caudal margin 130 9.15 Upper postventral caudal margin 230 16.19 Subterminal caudal margin 40 2.81 Subterminal caudal width 60 4.22 Terminal caudal margin 62 4.36 Terminal caudal lobe 65 4.57 First dorsal length 140 9.85 First dorsal anterior margin 130 9.15 First dorsal base 68 4.78 First dorsal height 52 3.66 First dorsal inner margin 70 4.92 First dorsal posterior margin 60 4.22 Second dorsal length 150 10.56 Second dorsal anterior margin 125 8.80 Second dorsal base 90 6.33 Second dorsal height 80 5.63 Second dorsal inner margin 70 4.92 Second dorsal posterior margin 78 5.49 Pelvic length 190 13.38 Pelvic anterior margin 140 9.85 Pelvic base 130 9.15 Pelvic height 100 7.04 Pelvic inner margin length 82 5.77 Pelvic posterior margin length 135 9.50 Head height 130 9.15 Trunk height 170 11.97 Abdomen height 195 13.73 Tail height 80 5.63 Caudal peduncle height 45 3.16 First dorsal midpoint-pelvic origin 280 19.71 Pelvic midpoint-first dorsal insertion 350 24.64 Pelvic midpoint-second dorsal origin 20 1.40 Mouth length 60 4.22 Mouth width 105 7.39 Upper labial furrow length 20 1.40 Lower labial furrow length 25 1.76 Nostril width 15 1.05 Internarial space 40 2.81 Anterior nasal flap length 15 1.05 Interorbital space 70 4.92 Spiracle length 20 1.40 Eye spiracle space 25 1.76 Head width 180 12.67 Trunk width 200 14.08 Abdomen width 200 14.08 Tail width 65 4.57 Caudal peduncle width 30 2.11 Figure 1. Adult female 1420 mm total length of Dalatias licha. a) lateral view, b) dorsal view, c) upper jaw teeth, d) lower jaw teeth. Before the present study, the specimen from Venezuela was the only documented record from the Caribbean Sea and the most recent record in the western Atlantic. The specimens recorded from the Caribbean were both mature females of the same size (1420 mm TL) over the length at maturity (1170-1200 mm TL) (Castro 2011, Ebert et al. 2021). Additionally, 14 specimens from the western Atlantic, mainly from the northern Gulf of Mexico and the Gulf of Maine, have been found in ichthyological collections (Table S2). During the same fishing trip, two other deepwater species were incidentally caught along with D. licha, the dwarf sicklefin chimaera Neoharriotta carri Bullis & Carpenter, 1966 (663-1090 mm TL) and the whitesaddled catshark Scyliorhinus hesperius Springer, 1966 (440-480 mm TL). Both species have been previously reported in the study area (Hacohen-Domené et al. 2016, Polanco-Vásquez et al. 2017) in addition to the sharpnose sevengill shark Heptranchias perlo (Bonnaterre, 1788), which was recently documented from the same fishing village (El Quetzalito) in the Guatemalan Caribbean (Hacohen-Domené et al. 2017). The presence of the Cayman Trench near the Guatemalan Caribbean coast could explain the record of these deepwater shark species. The Cayman Trench is a narrow, deep linear basin immediately north of the Nicaraguan Rise, notable for being the site of contemporary sea-floor spreading. It extends from the Gulf of Honduras to southeastern Cuba. It has the deepest zones of the entire Caribbean (with regions deeper than 6000 m) and is bounded on the north and south sides by steep walls (Donnelly 1994). With the record of D. licha, the number of shark species known in the Guatemalan Caribbean increased to 25. The few reports of this species in the Caribbean Sea reflect that current encounter rates in the fishery are low; however, the expansion of coastal fisheries to deeper waters presents an emerging threat to vulnerable deepwater assemblages of elasmobranchs as targeted and incidental catch (Baremore et al. 2021, Talwar et al. 2022). Acknowledgments Fundación Mundo Azul thanks El Quetzalito’s fishers for their support while monitoring elasmobranch landings and Consejo Nacional de Áreas Protegidas (CONAP) for permitting this research. We thank Dr. Dave Ebert for his assistance in the morphological identification of the specimen. Grants from the Rufford Foundation and The Summit Foundation funded this project. Conflict of interest statement: The authors declare no conflict of interest. Ethics approval: All research activities were conducted under permit Bno.1048, issued by Consejo Nacional de Áreas Protegidas (CONAP). Data and materials availability: The specimen is available at the Centro de Estudios del Mar y Acuicultura (CEMA) collection of the Universidad de San Carlos de Guatemala (USAC) under reference N°166. Additional photographic material is available on request. References Baremore, I.E., Graham, R.T. & Matthew, J.W. 2021. Fishing down the reef slope: characteristics of the nearshore deepwater fisheries of Mesoamerica. Ocean and Coastal Management, 211: 105773. doi: 10.1016/j.ocecoaman.2021.105773 Bigelow, H.B., Perez-Farfante, I. & Schroeder, W.C. 1948. Fishes of the western North Atlantic, Part 1: lancelets, cyclostomes, and sharks (Memoir Sears Foundation for Marine Research, N°1). Yale University, New Hav
View PDF -
New record and range extension of the roughskin spurdog Cirrhigaleus asper in the Caribbean Sea
New record and range extension of the roughskin spurdog Cirrhigaleus asper in the Caribbean Sea Francisco Polanco-Vásquez¹,², Ana Hacohen-Domené¹,³*, Edgar E. Becerril-García⁴, Sebastián Hernández⁵,⁶ ¹ Fundación Mundo Azul, Guatemala, Blvd. Rafael Landivar 10-05, Paseo Cayala Zona 16, Ciudad de Guatemala, Guatemala. ² Wildlife Conservation Society, Avenida 15 de Marzo, Casa #3, Flores Petén, Guatemala ³ Departamento de Biología, Facultad de Ciencias y Humanidades, Universidad del Valle de Guatemala, 18 Av. 11-95 Zona 15, Vista Hermosa III, Ciudad de Guatemala, Guatemala 4 Instituto Politécnico Nacional, Centro Interdisciplinario de Ciencias Marinas, 23096, La Paz, México 5 Laboratorio de Biología Molecular (BIOMOL), Centro de Programas Internacionales y Estudios de Sostenibilidad, Universidad Veritas, San José, Costa Rica 6 Sala de Colecciones Biológicas, Facultad de Ciencias del Mar, Larrondo 1281, Universidad Católica del Norte, Coquimbo, Chile *Corresponding author: anahacohen@gmail.com Abstract This study constitutes the first record and a range extension of the roughskin spurdog (Cirrhigaleus asper) in the Caribbean Sea. A total of three mature female specimens were captured by artisanal fishermen between March and May of 2016 in the coastal community of El Quetzalito, Izabal, Guatemala. The total length of the sharks ranged from 1,110-1,280 mm, which is the largest total length so far reported for this species. Keywords Deep-sea species, elasmobranch, Squalidae, Guatemala Introduction The family Squalidae (dogfish sharks) includes two genera: Cirrhigaleus (Tanaka, 1912) with three species; and Squalus (Linnaeus, 1758) with 26 species (Ebert et al. 2015). This family is distributed worldwide in temperate and tropical seas, with a preference for deep environments (>50 m) where they feed on benthic fishes and invertebrates (Compagno 2002, Compagno et al. 2005, Ebert et al. 2015). In the Atlantic, eleven species are reported (Compagno 2002, Ebert et al. 2015, Pfleger et al. 2018, Veríssimo et al. 2016, Viana et al. 2016, Finucci et al. 2020a). The roughskin spurdog Cirrhigaleus asper Merrett, 1973 was first described by Merrett (1973) in the equatorial western Indian Ocean based on a 901 mm total length (LT) mature male holotype. This species has been reported in the South Atlantic Ocean, West and Central Indian Ocean and in the Central Pacific Ocean (Hawaiian Islands). In the Western Atlantic, C. asper has been reported from North Carolina to Florida, in the Gulf of Mexico and the South West of Brazil with no records in the Caribbean Sea (Compagno 2002, Castro 2011, Ebert et al. 2015, Rincon et al. 2017, Del Moral-Flores et al. 2018). According to Ebert et al. (2015) and Finucci et al. (2020b), C. asper inhabits continental shelves and insular slopes of warm temperate to tropical seas, ranging from 0-1,370 m. However, it can also be observed in river mouths and outer bays (Compagno 1984, Ebert et al. 2015). The biological information of C. asper is deficient. The age of maturity for this yolk sac viviparous species is unknown, as well as longevity and gestation (Finucci et al. 2020b). However, size at maturity occurs between 89-118 cm for females, and 85-90 cm for males, with a size of 25-28 cm at birth, and a fecundity of 18-22 pups (Ebert et al. 2013, Finucci et al. 2020b). In terms of conservation status, C. asper is listed as “Data Deficient” due to the scarce information available to assess extinction risks based on their distribution and population trends by the International Union for Conservation of Nature (IUCN) (Finucci et al. 2020b). This report refers to a new record and range extension of C. asper, providing the first scientific evidence of the occurrence of C. asper off the coast of Guatemala, in the Caribbean Sea, based on three female specimens captured as bycatch of artisanal fisheries. Materials and Methods Specimens examined and morphometrics Three specimens of Cirrhigaleus asper were incidentally captured by artisanal fishermen from the coastal community of El Quetzalito, Izabal, Guatemala, at coordinates 15°52.374 N, 88°18.712 W (see Figure 1: Study area and capture location). Two specimens were captured on March 20th, 2016 using a 1,000 m long bottom trammel mesh net with 3.5 inches mesh and one panel. A third specimen was captured on May 18th, 2016 using a 2,000 m long line with 200 hooks (#16). All three specimens were captured at approximately 200 m depth, based on the known length of the fishing gear used. All specimens were examined and identified using identification guides (Compagno 1984, Compagno et al. 2005, Ebert et al. 2015). Regarding morphometry, a total of 76 measurements (following Compagno 2002) were registered for the specimen Id_215 (Table 1; Fig. 2a). Additionally, tissue sample was collected, for genetic identification, only for the specimen Id_235. Unfortunately, deposition of any specimen in a museum/academic collection was not possible due to the fisherman’s decision to use the meat. Genetic identification DNA was extracted using the Wizard Genomic DNA Purification Kit (PROMEGA®, Promega Inc., Madison, WI). The cytochrome oxidase subunit one (COI or CO1 ) was amplified by PCR using the following primers FISH F2: 5TCGACTAATCATAAAGATATCGGCAC’ and FISH R2: 5’ACTTCAGGGTGACCGAAGAATCAGAA3’ (Ward et al. 2005). Amplifications were carried out in a PCR of 15 μL of volume with 10X PCR buffer, 25 mM MgCl2 , 10 mM dNTPs, 10 μM of each primer, 5 units of Dream Taq polymerase (Thermo ScientificTM) and 1 μL of DNA. PCR was performed on a SimpliAmp cycler (Applied Biosystem, USA). An initial denaturing step was carried out at 95 °C for 2 min, followed by 30 cycles with 30 s at 94 °C, 30 s at 55 °C, and 1 min at 72 °C, followed by a final extension step of 10 min at 72 °C. The PCR products were sent to the molecular cloning laboratory (MCLAB) in the USA for Sanger sequencing on an ABI 3730 XL Genetic analyzer in both the forward and reverse directions. Forward and reverse sequences were edited and aligned using the GENEIOUS v10.2.3 software to solve ambiguities for the confirmation of nucleotide bases. Sequence divergences were calculated using a Kimura two-parameter (K2P) distance model (Kimura 1980). Neighbor-joining (NJ) tree of K2P distances were estimated to provide a tree representation of the divergence between the Cirrhigaleus species for the CO1 gene sequence obtained from from Barcode of Life DataSystems (BOLD) (Ratnasingham & Hebert 2007) and GenBank from the NCBI1 . The NJ tree was performed in MEGAX (Kumar et al. 2018) with 1000 replications. Figure 1. Study area and capture location (x) of Cirrhigaleus asper in the coastal zone of El Quetzalito, Izabal, Guatemala Table 1. Morphometric measurements (mm) of one female specimen of Cirrhigaleus asper (Id_215) captured by artisanal fishermen between March and May of 2016 in the coastal zone off El Quetzalito, Izabal, Guatemala Results and Discussion The species of the genus Cirrhigaleus are distinguished from Squalus species by having a very elongated secondary lobe and by forming nasal barbels that extend to the anterior margin of the mouth while species of the genus Squalus have anterior nasal flaps with a short secondary lobe and, without forming nasal barbels (Compagno et al. 2005). The species of the genus Cirrhigaleus evidenced a similar length in both dorsal fins while in the Squalus species the second dorsal fin is smaller and lower than the first dorsal fin (Compagno et al. 2005). In Cirrhigaleus species, the second dorsal fin spine it is equal in length to the first dorsal fin spine. In contrast, Squalus species show a second dorsal fin spine larger than the first dorsal fin spine. In general, the body of the Cirrhigaleus species is robust and markedly humped dorsally, when compared with the genus Squalus, in which the members of this group evidenced a fusiform body arched dorsally throughout all of its length (Viana et al. 2016). The specimens were identified as Cirrhigaleus asper due to the presence of a stocky body covered with a rough skin, a short-rounded snout and a broad flat head. The body showed a white pigmentation in the belly and a light brown color on the dorsal surface. The margins of the two dorsal fins were white and the second dorsal fin was about as large as the first, in which a strong and long spine was observed in both dorsal fins. The origin of the first dorsal was behind the pectoral fin rear tips (Compagno et al. 2005; Fig. 2a, b). Additionally, specimens examined had big nostrils and large-mouth upper labial furrows that were larger than the lower labial furrow length (Fig. 2a). Finally, the specimens presented anterior nasal flaps, with short barbels, a distinguished characteristic that differentiate C. asper from its congeners Cirrhigaleus babifer Tanaka, 1912 and Cirrhigaleus australis White, Last & Stevens, 2007 (Ebert et al. 2015). Specimens comprised the following morphometric measurements: Id_215: 1,160 mm total length (TL), 1,060 mm precaudal length (PCR), 960 mm fork length (FL) and mature female (Code number= Id_215) (Fig. 2a): Id_216: 1,100 mm TL, 1,030 mm PRC, 970 mm FL and mature female (Code number= Id_216); Id_235: 1,280 mm TL, 1,200 mm PRC, 1,080 mm FL and mature female (Code number= Id_235) (Fig. 2b). Figure 2. Cirrhigaleus asper specimens: a) Id_215 (1,160 mm TL, mature female); b) Id_235 (1,280 mm TL, mature female); c) Id_235, neighbourjoining phylogenetic tree of C. asper and related species, inferred from gene sequence (COI) Edited COI sequences were 573 bp long from the specimen identified as Id_235 from Guatemala, in the Caribbean coast (GenBank Accession number MN982926). The sequence is identical to an available voucher specimens of C. asper (DSFSF327-09), and only differing by one bp from the other sequences identified as C. asper obtained from GenBank (JF43139) and from two other voucher specimens of C. asper (SAIAE071-14 and CNSHK146-08). However, the CO1 sequence of Id_235 differed by 23 substitutions from those of two voucher specimens of C. australis (White et al. 2007) (FOA137-04 and FOAL645-10), and by 24 bp substitutions from one specimen of C. barbider (Kempster et al. 2013) (FOAE068-06). One sequence (KC349854) of Squalus crassispinus Last, Edmunds & Yearsley, 2007 (FOAFOO3-07), it was used as an out-group. The percentages of identity are represented and supported for each branch in the NJ tree (Fig. 2c). These specimens confirm the first record of the roughskin spurdog C. asper in the Caribbean Sea, off Guatemala. The species has been reported in the Western North Atlantic, the Gulf of Mexico (Campeche), on the southern coast of Brazil and the western coast of Venezuela (Península de Paraguaná) (Castro 1983, Compagno 2002, Fischer et al. 2006, Rincon et al. 2017, Del Moral et al. 2018, Ehemann et al. 2019). The roughskin spurdog is captured incidentally as a result of trawling, longline fishery, and tilefish fishery in the Southeastern coast of the United States (Compagno 2002). According to Compagno (1984) and Castro (2011), C. asper has no commercial importance to date. However, C. asper is captured incidentally with trammel net and longline in the Caribbean, off Guatemala, and in recent decades the fishers have sold its meat and liver oil to local markets, despite the low quality and price of the meat (Hacohen-Domené et al. 2020). Regarding body size, the maximum size reported for C. asper is 1,235 mm TL (Fischer et al. 2006). However, frequent sizes for males and females are 710 mm TL and 690 mm TL respectively (Fischer et al. 2006). In this manner, two out of three individuals reported in the present study coincide with the size range reported for this species (specimen Id_215 and Id_216). However, one specimen (Id_235) was longer (1,280 mm TL) than the maximum size reported; which constitutes the largest specimen recorded to date. Information on the reproduction of this species varies according to the l
View PDF -
First record of the scoophead shark (Sphyrna media) and new records of great hammerhead sharks (Sphyrna mokarran) in the Guatemalan Pacific
First record of the scoophead shark (Sphyrna media) and new records of great hammerhead sharks (Sphyrna mokarran) in the Guatemalan Pacific Ana Cristina Hérnandez a , Julio Sánchez-Jiménez a , María de los Angeles Rosales-Melgar a , Elisa M. Areano-Barillas a , Juan Carlos Pérez-Jiménez a,b, * a Fundación Mundo Azul, Km 21.5 carretera a Villa Canales, Guatemala, Guatemala b El Colegio de la Frontera Sur, Av. Rancho Polígono 2-A, Ciudad Industrial, Lerma, Campeche CP 24500, Mexico * Corresponding author at: Fundación Mundo Azul, Km 21.5 carretera a Villa Canales, Guatemala, Guatemala. E-mail address: (J.C. Pérez-Jiménez). Regional Studies in Marine Science 84 (2025) 104122. Accepted 7 March 2025. Available online 8 March 2025. Abstract A juvenile scoophead shark (Sphyrna media) and four juvenile great hammerhead sharks (Sphyrna mokarran) captured with longlines (<30 m depth) by small-scale fisheries off the coast of Buena Vista and Sipacate in the Guatemalan Pacific are reported. These species are categorized as Critically Endangered by the IUCN Red List, primarily due to overfishing. All the specimens were juveniles: a male S. media (71 cm TL) and four S. mokarran, including a female (114 cm TL) and three males (79.5, 122, and 149.5 cm TL). Sphyrna mokarran specimens recorded in our study are the smallest ever reported for the Eastern Pacific region. Sphyrna media specimen is the first recorded in the Guatemalan Pacific, increasing the number of hammerhead species to four and the total number of shark species recorded off the Guatemalan Pacific to sixteen. Keywords Sphyrnidae; Critically Endangered; uncommon sharks; Tropical Eastern Pacific; artisanal fisheries 1. Introduction The hammerhead sharks (family Sphyrnidae), so named because of the lateral expansion of the head, comprise sharks occurring in tropical and temperate waters worldwide (Gilbert, 1967); however, the small species, with the exception of Eusphyra blochii, are restricted to waters off the American continent (Ebert et al., 2021). The scalloped hammerhead (Sphyrna lewini Griffith and Smith, 1834) and the smooth hammerhead (Sphyrna zygaena Linnaeus, 1758) are common in the Eastern Pacific (Martínez-Ortíz et al., 2007; Galeana-Villaseñor et al., 2009; Pérez-Jiménez, 2014). The great hammerhead (Sphyrna mokarran Rüppell, 1837) has been recorded in the Central Mexican Pacific (Castillo-Geniz et al., 2016), Panama, and Guatemala (Guzman et al., 2019; Avalos-Castillo and Santana-Morales, 2021), and the bonnethead (Sphyrna tiburo Linnaeus, 1758), the scalloped bonnethead (Sphyrna corona Springer, 1940) and the scoophead shark (Sphyrna media Springer, 1940) have been recorded off Colombia, Panama, and Mexico (Castillo-Geniz, 2001; Torres-Huerta, 2008; Rico-Mejia and Rueda, 2007; Guzman et al., 2019). Along the Guatemalan Pacific coast, the most frequently caught shark is S. lewini (Ixquiac-Cabrera et al., 2009; Avalos-Castillo and Santana-Morales, 2021). Sphyrna mokarran and S. zygaena have also been reported in landings (Ixquiac-Cabrera et al., 2009). Notably, there is only one previously documented record of S. mokarran (Avalos-Castillo and Santana-Morales, 2021); however, no data on sex and size have been recorded. Our study is aimed to provide the first verified record of S. media and new records of S. mokarran in the waters of the Guatemalan Pacific. Sphyrna media is a small-sized (<150 cm total length, TL) hammerhead shark distributed in the Eastern Pacific from the Gulf of California, Mexico, to northern Peru and in the Western Atlantic from Panama to southern Brazil. It inhabits waters in continental shelves from inshore to 100 m depth (Compagno, 1984; Castro, 2011). In comparison, S. mokarran is a large (610 cm TL) coastal and semi-oceanic pelagic shark, wide-ranging in tropical and warm temperate waters (Compagno, 1984; Castro, 2011). Sphyrna media is captured in fisheries using bottom longlines, gillnets, and hook and line (Compagno, 1984; Kyne et al., 2012), which are typically unmanaged and operate throughout its range. The declining numbers of records over the past several decades and range contraction in some areas indicate that this shark has undergone population reduction in both the Pacific and the Atlantic (Pollom et al., 2020). Records are sparse from elsewhere in the Eastern Pacific (Pérez-Jiménez, 2014; Guzman et al., 2019). Therefore, it is inferred that S. media has experienced a population decline of 80 % due to high levels of fishing, leading to its category of Critically Endangered by the IUCN Red List (Pollom et al., 2020). Sphyrna mokarran is caught globally as a target and bycatch in coastal and pelagic large- and small-scale longline, purse seine, and gillnet fisheries and is often retained for the fins (Castro, 2011; Kyne et al., 2012; Ebert et al., 2021). Sphyrna mokarran has shown significant declines in several regions throughout its range, and its population has declined by 80 % over three generations; consequently, it has been categorized as Critically Endangered by the IUCN Red List (Rigby et al., 2019). 2. Records and discussion The historical presence of S. media and S. mokarran in the Eastern Pacific is well documented in ichthyological collections in Mexico (mainly in the Gulf of California), Costa Rica, and Panama (Table 1). It is important to highlight the lack of recent records in the Gulf of California, Mexico, despite intense landing monitoring surveys in recent decades (Pérez-Jiménez, 2014). Before our study, the most recent records of S. media were in 2009–2010 off Panama (Vega et al., 2023), and the most recent records of S. mokarran were in 2006–2014 in the Central Mexican Pacific (Castillo-Geniz et al., 2016) (Table 2). Table 1. Specimens of Sphyrna media (n = 40) and Sphyrna mokarran (n = 30) from the Eastern Pacific preserved in ichthyological collections. NA: not available. SIO = Scripps Institution of Oceanography; LACM = Natural History Museum of Los Angeles County; USNM = Smithsonian Institution National Museum of Natural History; FMNH = Field Museum of Natural History; IBUNAM = Colección Nacional de Peces, UNAM; CAS = California Academy of Sciences; YPM = Peabody Museum of Natural History; AMNH = American Museum of Natural History; CMN = Canadian Museum of Nature. In our study, we conducted landing monitoring in the fishery communities on the Central Guatemalan Pacific coast. Sphyrna media specimen was landed in the fishing community of Buena Vista, and the four S. mokarran specimens (including the one reported by Avalos-Castillo and Santana-Morales, 2021) were landed in Sipacate by artisanal boats (fiberglass outboard motored, 7.5–9 m in length), which target teleosts and rays using bottom longlines (J or Eagle Claw half circle hooks of 3–6 cm height) in the continental shelf at less than 30 m depth. Sphyrna media specimen was taxonomically identified following the descriptions by Compagno (1984), Castro (2011), and Ebert et al. (2021), such as a moderately broad, anteriorly arched, mallet-shaped head, with weak medial and lateral indentations on its anterior edge (Fig. 1). We used molecular methods to confirm visual identification due to the close morphological similarity with S. corona. We collected a muscle sample from S. media for genetic analysis to confirm species identity. Tissue samples were stored in 95 % ethanol, and total DNA extraction was performed using the Qiagen DNeasy Blood and Tissue Kit following the manufacturer’s protocol (Qiagen, Valencia, CA, U.S.A). A 772-base pair (bp) fragment of the mitochondrial COI region was amplified, and three independent replicates were run using the primers FishCoxI F1 (5´TCWACCAACCACAAAGAYATYGGCAC) and FishCoxI R1 (TARACTTCWGGGTGRCCRAAGAATCA), modified from Ward et al. (2005). Polymerase chain reaction (PCR) was performed as follows: 94 ˚C for 2 min., 35 cycles of 30 s at 94 ˚C, 55 ˚C for 45 s, and 72 ˚C for 40 s, followed by a final extension step of 72 ˚C for 10 min. Successfully amplified PCR products were purified using Exo-SAP (Thermo Scientific) and sequenced on an ABI 3500. All sequences were edited, checked manually, and aligned using GeneiousPrime (http://www.geneious.com). A BLAST search was performed in GenBank to compare the sequences against all available specimens, including potential matches with S. corona. Since no S. media sequences were available in GenBank, species identification was validated using genetically confirmed S. media samples from Colombia and Panama. Sphyrna mokarran specimens were taxonomically identified following the descriptions by Compagno (1984), Castro (2011), and Ebert et al. (2021), such as the anterior margin of the head nearly straight and with a median indentation and first dorsal fin very high and falcate (Fig. 2). We measured the total length (TL) in centimeters of all specimens using a metric tape. Fig. 1. Scoophead shark Sphyrna media (male of 71 cm TL), A) Lateral view, B) Dorsal view of the head. The male S. media measured 71 cm (TL) and landed on March 15, 2024 (Fig. 1). The first recorded S. mokarran was a male (122 cm TL) landed on February 12, 2020 (this is the one documented by Avalos-Castillo and Santana-Morales, 2021); the second record was a female (114 cm TL) landed on January 5, 2024 (Fig. 2A, B); the third record was a male (149.5 cm TL) landed on March 5, 2024 (Fig. 2C), and the fourth record was a male (79.5 cm TL) landed on June 5, 2024. The smallest S. mokarran (79.5 cm TL) was either a neonate or young of the year; the other S. mokarran and S. media specimens were juveniles. The size at maturity for S. media males has been estimated to be anywhere from 83 cm TL (Castro, 2011) to 100 cm TL (Ebert et al., 2021). Sphyrna mokarran males mature at 234–269 cm TL, and the females at 250–300 cm TL (Compagno, 1984). Additionally, the size at birth of S. mokarran is 50–70 cm TL (Compagno, 1984; Ebert et al., 2021). Fig. 2. Great hammerhead shark Sphyrna mokarran, A) Lateral view of a male (114 cm TL), B) Dorsal view of a male (114 cm TL), C) Dorsal view of a male (149.5 cm TL). With the inclusion of our record of S. media, the number of hammerhead species recorded in the Guatemalan Pacific now is four, including S. lewini, S. zygaena, and S. mokarran (Ixquiac-Cabrera et al., 2009; Avalos-Castillo and Santana-Morales, 2021), and increased to 16 the total number of shark species off Guatemalan Pacific coast. The relevance of the S. media record relies on the recent scarcity of records for this species in the Eastern Pacific (Table 2). Moreover, the sizes of S. mokarran reported in our study are the smallest recorded for the Eastern Pacific region, underscoring the importance of continuous monitoring of landings along the Guatemalan Pacific coast. Table 2. Biological data of Sphyrna media (n = 26) and Sphyrna mokarran (n = 263) from the Eastern Pacific, recorded in fisheries landings since 1999. NA: not available. Country Year of the records Number of records Size (cm, TL) Sex Reference Sphyrna media Guatemala 2024 1 71 Male Present study Panama 2009–2010 18 29.3–77.5 Both Vega et al. (2023) Panama 2007–2009 1 NA NA Guzman et al. (2019) Mexico 2006–2007 1 156 Male Torres-Huerta (2008) Mexico 1999–2001 2 NA NA Castillo-Geniz (2001) Colombia 2001 3 NA NA Navia and Mejía-Falla (2016) Sphyrna mokarran Guatemala 2020–2024 4 79.5–149.5 3 males, 1 female Present study Mexico 2006–2014 253 140–342 Both Castillo-Geniz et al. (2016) Mexico 2010 1 424 Female Tovar-Ávila and Gallegos-Camacho (2014) Panama 2007–2009 2 NA NA Guzman et al. (2019) Mexico 2005–2006 3 NA NA Galeana-Villaseñor et al. (2009) Ethics approval All research activities were conducted under permit Bno.1604, issued by Consejo Nacional de Áreas Protegidas (CONAP), and the collect B-01605 and research permits B-00923. Author statement We, the authors, declare that the work described in this manuscript has not been published previously. This manuscript is not under consideration for publication e
View PDF -
Extinction risk, reconstructed catches and management of chondrichthyan fishes in the Western Central Atlantic Ocean
Extinction risk, reconstructed catches and management of chondrichthyan fishes in the Western Central Atlantic Ocean Brendan S. Talwar, Brooke Anderson, Cristopher G. Avalos-Castillo, María del Pilar Blanco-Parra, Alejandra Briones, Diego Cardeñosa, John K. Carlson, Patricia Charvet, Charles F. Cotton, Zoe Crysler, Danielle H. Derrick, Michael R. Heithaus, Katelyn B. Herman, Olga Koubrak, David W. Kulka, Peter M. Kyne, Oscar M. Lasso-Alcalá, Paola A. Mejía-Falla, Jorge Manuel Morales-Saldaña, Beatriz Naranjo-Elizazu, Andrés F. Navia, Nathan Pacoureau, Juan Carlos Pérez-Jiménez, Riley A. Pollom, Cassandra L. Rigby, Gabriela Sofía Rincón-Vargas, Rima W. Jabado, Nicholas K. Dulvy y colaboradores Fish and Fisheries, 2022. DOI: 10.1111/faf.12675. Received 24 January 2022; Revised 30 April 2022; Accepted 2 May 2022. Correspondence: Brendan S. Talwar, Institute of Environment, Department of Biological Sciences, Florida International University, 3000 NE 151st Street, North Miami, FL 33181, USA. Email: talwar.brendan@gmail.com Funding: Shark Conservation Fund. Abstract Chondrichthyan fishes are among the most threatened vertebrates on the planet because many species have slow life histories that are outpaced by intense fishing. The Western Central Atlantic Ocean, which includes the Greater Caribbean, is a hotspot of chondrichthyan biodiversity and abundance, but has been characterized by extensive shark and ray fisheries and a lack of sufficient data for effective management and conservation. To inform future research and management decisions, we analysed patterns in chondrichthyan extinction risk, reconstructed catches and management engagement in this region. We summarized the extinction risk of 180 sharks, rays and chimaeras, including 66 endemic and 14 near-endemic species, using contemporary IUCN Red List assessments. Over one-third (35.6%) were assessed as Vulnerable, Endangered or Critically Endangered, primarily due to overfishing. Reconstructed catches from 1950 to 2016 peaked in 1992, then declined by 40.2% thereafter. The United States, Venezuela and Mexico were responsible for most catches in the region and hosted the largest proportions of the regional distributions of threatened species, largely due to having extensive coastal habitats in their Exclusive Economic Zones. The quantity and taxonomic resolution of fisheries landings data were poor in much of the region, and national-level regulations varied widely across jurisdictions. Deepwater fisheries represent an emerging threat, although many deepwater chondrichthyans currently have refuge beyond the depths of most fisheries. Regional collaboration as well as effective and enforceable management informed by more complete fisheries data, particularly from small-scale fisheries, are required to protect and recover threatened species and ensure sustainable fisheries. Keywords Fisheries, IUCN Red List, marine policy, rays, sharks, threats INTRODUCTION Fishing has outpaced the slow life histories of many sharks and their relatives (class Chondrichthyes, hereafter ‘sharks and rays’; Cortés, 2000; Worm et al., 2013) and has led to an estimated one- third (37.5%) of sharks and rays being threatened with extinction (Dulvy, Pacoureau, et al., 2021). Oceanic sharks and rays present a striking example; between 1970 and 2018, an 18-fold increase in relative fishing pressure reduced their global abundance by 71% (Pacoureau et al., 2021). Sharks inhabiting coral reefs are similarly threatened, with fishing likely responsible for sharks being absent from almost 20% of reefs surveyed globally (MacNeil et al., 2020). The depletion of shark and ray populations could lead to ecosystem- level consequences (Burkholder et al., 2013; Estes et al., 2016; Ferretti et al., 2010) because many of these fishes are apex or mesopredators that range widely and may affect ecosystem pro- cesses through predation and associated risk effects, competition, nutrient transport and bioturbation (Flowers et al., 2021; Heithaus et al., 2008, 2010; Heupel et al., 2014). In recent decades, increased concern for fisheries impacts on sharks and rays gave rise to numerous initiatives designed to stem or reverse population declines at the national and international level (Shiffman & Hammerschlag, 2016). In 1991, for example, the International Union for Conservation of Nature (IUCN) Species Survival Commission (SSC) Shark Specialist Group (SSG) was founded to promote the sustainable use and conservation of sharks and rays (Fowler et al., 2005), and, in 1993, the United States im- plemented its Fishery Management Plan for sharks in the Atlantic Ocean (NMFS, 1993). Additionally, in the late 1990s, the United Nations (UN) Food and Agriculture Organization (FAO) developed the International Plan of Action for Conservation and Management of Sharks (IPOA–Sharks), which recommended countries create and implement their own National Plans of Action for sharks and rays (NPOA–Sharks; FAO, 1999). Other management measures (e.g. trade restrictions) were introduced over the next twenty years, but their full implementation is a challenge (Lawson & Fordham, 2018), and their effectiveness remains to be demonstrated on a global scale (Davidson et al., 2016) despite some promising local outcomes (e.g. devil rays [Mobulidae]—Indonesia; Booth, Pooley, et al., 2020). In the Greater Caribbean, robust shark and ray management is generally lacking (Davidson et al., 2016) outside of the United States (Fowler et al., 2005), and, one decade ago, management was described as a patchwork of inconsistent measures (Kyne et al., 2012). Further, the Greater Caribbean was recently one of the most data-deficient regions for sharks and rays in the world (Dulvy et al., 2014). According to the IUCN Red List of Threatened Species (IUCN Red List) in 2012, nearly half (47%) of the region's shark and ray species were assessed as Data Deficient, and nearly one in five (19%) were assessed in a threatened category, primarily due to overfishing (Kyne et al., 2012). Some historical accounts and archaeological data suggest that fishing had depleted large marine vertebrates in the Caribbean even before modern fishing technol- ogy and scientific research expanded in the mid-1900s (Jackson et al., 2001; McClenachan et al., 2006; Wing & Wing, 2001), al- though these conclusions are debated (e.g. see Baisre, 2010; McClenachan et al., 2010). As recently as the 1950s, however, sharks were still described as highly abundant (Viele, 1996; Ward- Paige et al., 2010), possibly illustrating the shifting baselines con- cept (Pauly, 1995). Contemporary trends in shark abundance in the Greater Caribbean have been derived from time-series catch data from fisheries-independent surveys and US-based fisheries (including the pelagic longline fleet that covers much of the Caribbean). These data suggest declines in the abundance or size of some coastal (Cortés et al., 2002; Hayes et al., 2009; Powers et al., 2013) and oceanic sharks (Baum & Blanchard, 2010; Cortés et al., 2007; Jiao et al., 2009), particularly following intense fishing in the 1980s (Bonfil, 1997; Castro, 2013; Musick et al., 1993). The magnitudes of some widely- reported declines in the region's shark abundance are debated (see Baum et al., 2003; Baum & Myers, 2004; Burgess et al., 2005). Fisher surveys (Graham, 2007) and spatial variation in relative abundance also suggest fishing caused declines in some coastal shark popu- lations. Notably, abundance is often highest in heavily managed Exclusive Economic Zones (EEZs; MacNeil et al., 2020), marine re- serves (Bond et al., 2012; MacNeil et al., 2020), shark sanctuaries (Clementi et al., 2021) and remote areas far from human population centres (Ward-Paige et al., 2010). There are, however, signs of recent stability and/or recovery in some better-studied shark populations in the United States (Carlson et al., 2012; Peterson et al., 2017), The Bahamas (Hansell et al., 2018; Talwar et al., 2020) and Belize (Bond et al., 2017; Flowers et al., 2022), largely due to targeted manage- ment that began in the 1990s (Castro, 2013; Ward-Paige, 2017). Otherwise, a lack of data has challenged the assessment of shark population trends. Ray (superorder Batoidea) population trends are poorly known in the Greater Caribbean and, for coastal species, trends vary spatially. For example, precipitous declines in sawfish (Pristidae) abundance are well documented across the entire region (Bonfil et al., 2017; Fernandez-Carvalho et al., 2014; Thorson, 1982), but at least one highly managed, well-studied population of Smalltooth Sawfish (Pristis pectinata, Pristidae) is stable and likely recovering in the United States (Brame et al., 2019). Additionally, diver observa- tions from 1994 to 2007 suggested that Yellow Stingray (Urobatis jamaicensis, Urotrygonidae) abundance declined on coral reefs but increased in some areas where predator populations were over- fished (e.g. Jamaica; Ward-Paige et al., 2011). Important ray (and shark) habitats, such as coral reef, seagrass and mangrove ecosys- tems (White & Sommerville, 2010), have also been degraded in the Greater Caribbean (Jackson et al., 2014; Polidoro et al., 2010; Waycott et al., 2009), which can lead to range contractions and in- creased extinction risk (Yan et al., 2021). Chimaera (i.e. ghost shark, order Chimaeriformes) population trends are unknown in the Greater Caribbean, but chimaeras typically reside in deep offshore waters, are caught as bycatch, and have little commercial value (Finucci et al., 2021). Globally, their contribution to total chondrichthyan catches is very low (Dulvy et al., 2014). Further, chimaeras primarily reside at depths beyond the maximum depth of most Caribbean fisheries (Finucci et al., 2021). Their populations, along with the populations of deepwater sharks and rays, are prob- ably stable as a result (Dulvy et al., 2014), but remain understudied. Recently, there have been efforts to reduce data deficiency and improve management for sharks and rays in this region. In 2017, the FAO Western Central Atlantic Fishery Commission (WECAFC), a regional fisheries advisory body that hosts members that fish or are located in FAO Major Fishing Area 31 (Western Central Atlantic; WCA) and the northern part of FAO Major Fishing Area 41 (Southwest Atlantic), convened the first meeting of the working group on shark and ray conservation and management. The work- ing group highlighted the need to coordinate national and regional management and made several specific recommendations regarding shark and ray fisheries (WECAFC, 2018). It also reviewed a Regional Plan of Action (RPOA–Sharks), a regionally tailored version of the IPOA–Sharks meant to facilitate collaboration in research, data col- lection, and management. Formal adoption of the RPOA–Sharks was intended for early 2020 (WECAFC, 2019), but it remains in draft form at the time of this writing. To inform future research and upcoming management decisions, we summarize updated global assessments of shark and ray extinc- tion risk for species found in the WCA using data from the IUCN SSC SSG's Global Shark Trends Project (Dulvy, Pacoureau, et al., 2021). We analyse extinction risk according to taxonomy, maximum depth of occurrence and trophic position. We then examine key threats, particularly fishing, and review current shark and ray management at the national (states and territories) and international level. MATERIALS AND METHODS Application of the IUCN Red List Categories and Criteria Twenty regional experts and members of the IUCN SSC SSG met for five days at the Cape Eleuthera Institute in Eleuthera, The Bahamas in June 2019. The IUCN Red List Categories and Criteria (Version 3.1) were applied to 113 species of sharks and rays following the Guidelines for Using the IUCN Red List Categories and Criteria (IUCN, 2012; IUCN Standards and Petitions Subcommittee, 2019). Assessments were conducted at the global level (i.e. for the
View PDF -
Eastern Pacific Round Rays
Eastern Pacific Round Rays Jorge Manuel Morales-Saldaña, Katelyn B. Herman, Paola A. Mejía-Falla, Andrés F. Navia, Elisa Areano, Cristopher G. Avalos Castillo, Mario Espinoza, Ana Cevallos, Adriana González Pestana, Alejandra González, Juan Carlos Pérez-Jiménez, Ximena Velez-Zuazo, Patricia Charvet and Peter M. Kyne In: DellaSala, D.A., Goldstein, M.I. (Eds.), Imperiled: The Encyclopedia of Conservation, vol. 2. Elsevier, 2022, pp. 773–783. https://dx.doi.org/10.1016/B978-0-12-821139-7.00122-7 Glossary Bycatch species: Species taken incidentally during fishing operations targeting other species. Species caught as bycatch can be landed (generally termed byproduct) or released at sea alive (although may be injured) or dead. Chondrichthyans: The cartilaginous fishes; a diverse group of 1250 fishes characterized by a skeleton mainly composed of cartilage. This group includes sharks, rays, and chimaeras (ghost sharks). Eastern Pacific Ocean: The Pacific Ocean region associated with the American continents; spanning from Alaska in North America to Chile in South America. Elasmobranchs: A sub-group of chondrichthyans (cartilaginous fishes) that comprise the sharks and rays; but not the chimaeras (ghost sharks). Gillnets: Fishing gear that consists of a mesh net made of nylon that is suspended vertically in the water column. Nets vary in length and mesh size and can be set on the bottom or in the water column. Industrial fisheries: Those fisheries where the total capital investment is relatively large (e.g., larger fishing vessels, longer range, sophisticated fishing equipment, long-term fish storage), and fishery products are for domestic or global markets. Longlines: A fishing gear that consists of a long monofilament mainline suspended horizontally in the water column or on the seabed with baited hooks (hundreds to thousands of hooks) attached separately along the mainline. Small-scale fisheries: In a broad sense, those fisheries where the total capital investment is relatively low (e.g., small fishing boats, restricted range, limited technology), which usually operate nearshore, and where the fishery products are for subsistence consumption or for local and domestic markets. Often referred to as artisanal or subsistence fisheries. Target species: Species that are intended to be caught by a particular fishery. Trawls: A fishing gear that is comprised of nets dragged on the seabed (benthic trawls) or in the water column (pelagic trawls). Trawls are largely non-selective fishing gear and, because of the direct physical damage to the seafloor, are considered one of the most destructive fishing methods. Abstract Due to the ongoing and increasing demand for their products, chondrichthyan populations are often subject to intense exploitation by many small-scale and industrial fisheries worldwide. This situation generates an urgent need for conservation and management of many chondrichthyan species. This includes the Eastern Pacific round rays of the family Urotrygonidae, which are small, inconspicuous, and commonly overlooked throughout most of the range. The present article provides an overview of the endemic round rays of the Eastern Pacific (United States to Chile) and summarizes the existing information of several aspects of this group, including their diversity, geographic range and habitat, life history traits, main threats, and conservation status. Of 17 round ray species globally, 14 are found in the Eastern Pacific. Conservation concern has been raised for three threatened and six Near Threatened species. Round rays are commonly caught as bycatch, retained or dis- carded, by a diversity of both small-scale and industrial fisheries that operate throughout their range which either lack management or effective enforcement of regulations. This highlights the need to closely monitor the populations of these species and conduct research to develop conservation and management strategies. As with many other elasmobranchs, there is a significant lack of biological, ecological, and fishery-related data (e.g., landings, catch rates) for most round ray species. This situation hampers the development of conservation plans for the threatened species and underlines the need to create adequate fishery monitoring and management programs. The Critically Endangered reticulate round ray, a narrow range endemic of the Gulf of Panama, is an urgent priority for conservation planning with no reports of its persistence since 1990. Improving fishery management will be critical to prevent further decline and extinction of the Eastern Pacific round ray populations. Introduction Globally, sharks and their relatives face an elevated risk of extinction (IUCN, 2021). The impact of fisheries and other human- induced stressors such as habitat loss and degradation have caused 36% of chondrichthyan fishes assessed to be considered threat- ened with global extinction (IUCN, 2021). This places chondrichthyans among the highest extinction risk levels of assessed vertebrates and highlights the urgent need to implement effective fishery management and conservation planning that may prevent extinctions and ensure the survival of their populations. Critical information gaps regarding the status and impact of threats remain for many species. This lack of information is particularly evident for those species that are poorly known, non-charismatic, and that usually fetch a low market price or have no value for their products. These factors mean that such species are commonly overlooked by fisheries management. One such group which have been traditionally disregarded are the round rays (family Urotrygonidae). Round rays are small stingrays (maximum size of <70 cm total length; TL) distributed exclusively in tropical and temperate coastal marine waters of North, Central, and South America. They are commonly found in nearshore environments and are mainly associated with soft- sediment seafloor habitats, where they are able to find their prey, usually crustaceans, mollusks, polychaetes, and bony fishes. As a result of their demersal habit (i.e., species associated with the seafloor) and low mobility, these species are commonly caught as bycatch in bottom trawl fisheries. Due to their small body size and low or no economic value, they are commonly discarded overboard, usually dead or seriously injured, but are also sometimes retained for the local market. Many of the fisheries which catch them lack effective management (e.g., low taxonomic resolution of catch data, limited monitoring, limited catch regulations, poor enforcement) which not only hinders their management and conservation but may also lead to unnoticed population depletions. This article presents an overview of the current status of endemic round rays of the Eastern Pacific, which contains 14 of the 17 species belonging to this family. This article provides a summary of several important aspects of this group, including their diversity, geographic range and habitat, life history traits, main threats, and conservation status. It also highlights the current extinction risk of species in order to create awareness of the decline in some species and the importance of implementing management measures before their populations reach the point of no return. Diversity Worldwide there are 26 recognized families of rays (Last et al., 2016). The family Urotrygonidae, or round rays, are a family of sting- rays comprising 17 species across two genera: Urobatis (6 species) and Urotrygon (11 species). For the most part, these species (14 species; 82%) are endemic to the Eastern Pacific Ocean (Fig. 1 shows some examples of round rays). The remaining species, yellow round ray Urobatis jamaicensis, smalleye round ray Urotrygon microphthalmum, and Venezuelan round ray Urotrygon venezuelae, are distributed in the Western Atlantic (Last et al., 2016). Species within this family are characterized by their disc, or body, which is nearly round in shape, which gives the group their common name. However, the body of most species is wider than it is long, giving the appearance of an oval shape. The group also displays several other notable characteristics, such as the lack of dorsal or anal fins, a snout ranging from very pronounced to almost imperceptible, and a short tail, usually no longer than the body length, with a serrated stinging spine and a caudal fin (Last et al., 2016). Some species also exhibit small, bluntly tipped or pointed thorns on their dorsal surface. Dorsal coloration varies from dark brown with small and irregular brownish-black blotches, e.g., blotched round ray Urotrygon chilensis, to yellowish or whitish densely covered with fine brownish or orange reticulations, e.g., the leopard round ray Urobatis pardalis, from which the species derives its name. Fig. 1. Examples of the diversity of Eastern Pacific round rays. (A) Tumbes round ray Urobatis tumbesensis; (B) blotched round ray Urotrygon chilensis; (C) spotted round ray Urobatis maculatus; (D) Haller’s round ray Urobatis halleri. Photo credits: Adriana González Pestana (Photos A and B), Sebastian Hernandez Muñoz (Photo C), Steven Lara (Photo D). Geographic range and habitat The distribution of round rays in the Eastern Pacific varies widely. The most broadly distributed species is Haller’s round ray Urobatis halleri, ranging from northern California, United States to northern Peru. Other species are restricted to smaller areas: e.g., the dwarf round ray Urotrygon nana ranges from central Mexico to Panama; the Tumbes round ray Urobatis tumbesensis from Colombia to northern Peru, and the Cimar round ray Urotrygon cimar from central Mexico to Costa Rica. There are also some species endemic to specific countries. This is the case for the bullseye round ray Urobatis concentricus which is endemic to Mexico, the reticulate round ray Urotrygon reticulata, which is only found in the Gulf of Panama, and the leopard round ray, which is present only in Costa Rica. Although there have been reports of these last two species outside of their endemic range, they have not been confirmed yet and as such, these species are treated as endemic at the country level. Round rays range across 11 Eastern Pacific countries, with varying levels of species richness. Mexico and Costa Rica have the greatest number of round rays, while species richness in the United States and Chile is relatively low (Fig. 2). Furthermore, there are some regions with high species richness, such as the Gulf of California (Mexico), coastal areas from the Gulf of Tehuantepec (Mexico) to the Gulf of Panama and from southern Colombia to Ecuador (Fig. 3). Round rays are mostly found in tropical waters, with some species such as Haller’s round ray ranging into temperate waters. They primarily inhabit coastal and continental shelf waters at depths <100 m. However, Roger’s round ray Urotrygon rogersi was recently caught by bottom trawling in the Gulf of California at a depth of 235 m (Acevedo-Cervantes et al., 2017). This report not only repre- sents the deepest record for this species, which usually inhabits between 2 and 30 m but is also the greatest depth reported for any round ray so far. Rounds rays are commonly associated with soft-bottom benthic habitats (e.g., mud and sand) and rubble substrates. Some species, such as Haller’s round ray, can also be found near coral reef ecosystems; other species, including the dwarf round ray and Tumbes round ray, have also been reported in estuaries and mangrove environments, which demonstrates the diver- sity of coastal shallow water habitats exploited by this group of rays. Fig. 2. Number of species of round rays in each Eastern Pacific country from north to south. Fig. 3. Map of species richness of Eastern Pacific round rays. The map was compiled based on the current geographic ranges and maximum depths reported for each species (from IUCN, 2021). Urobatis marmoratus is not plotted on the map since the depth range for this
View PDF -
Hunt for the Easter Sharks: A genetic analysis of shark and ray meat markets in Guatemala
Hunt for the Easter Sharks: A genetic analysis of shark and ray meat markets in Guatemala Devanshi Kasana, Hector Daniel Martinez, Julio Sánchez-Jiménez, Elisa Areano, Ana Hacohen-Domené, Rachel T. Graham, Demian D. Chapman Fisheries Research 283 (2025) 107300. Available online 16 February 2025. doi:10.1016/j.fishres.2025.107300 Abstract Guatemala, situated in Central America along the eastern Pacific Ocean and the western Caribbean Sea, is a major regional consumer of elasmobranch (shark and ray) meat during the Roman Catholic Lenten season. Elasmobranch meat is supplied by a combination of domestic fisheries and imports. Despite being a component of economic and nutritional security for local communities, fisheries and trade lack monitoring and management. Limited information on species-specific landings and fisheries and trade supply chains is further complicated by Guatemala’s bicoastal geography, which necessitates the separation of landings by geographic origin for robust stock assessments and targeted management interventions. This study employs molecular techniques to identify the species and, for the main species in trade, ocean basin provenance, occurring in meat samples collected from domestic markets across Guatemala in 2022 as well as historical samples from 2016 and 2017. Successful genetic testing of 370 meat samples identified 19 shark and ray species in the trade, including many threatened species, as well as a significant proportion of species now listed under the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). It also revealed substantial (22 %) mislabelling of teleost fish as elasmobranchs. Pacific coast markets and the largest inland market (Guatemala City, the largest urban centre) predominantly relied on domestic and imported landings from the Pacific coast, while Guatemala City also had inputs from domestic and likely imported landings from the Atlantic coast. One Atlantic coastal market sampled was exclusively supplied from that basin. Some imports of Pacific Ocean species are reported to CITES but there is limited national management of pelagic and coastal shark and rays landings on the Pacific coast, which needs to be rectified given the importance of these species and populations to elasmobranch meat consumption in Guatemala. Better enforcement of CITES is required to ensure sustainable imports of Atlantic Ocean sharks, while recent efforts to manage Atlantic domestic landings needs to be continued and likely expanded to promote sustainability. Introduction Increasing market demand for shark and ray (“elasmobranch”) commodities in conjunction with trade growth continues to mount pressure on their populations worldwide (Jabado et al., 2015; Davidson et al., 2016). Expanding markets create trade networks that enable products to move “boat to plate”, i.e., from the point of capture to the consumer, through supply chains (Mundy and Sant, 2015). While the global trade in elasmobranch fins has been researched extensively (Clarke et al., 2007; Fields et al., 2018; Carde˜nosa et al., 2020, 2022), markets for elasmobranch meat on global, regional, and domestic scales remain poorly understood. However, trade in elasmobranch meat continues to surpass finsboth in terms of volume and valuecontributing to economic and nutritional security for a range of stakeholders in many coastal areas of the world (Glaus et al., 2019; Niedermüller et al., 2021; Seidu et al., 2022). Global elasmobranch meat trade networks are complex, evolving and geographically dispersed, incorporating new and less centralized supply chains with multiple domestic and international actors (Dent and Clarke, 2015). Transparency and traceability throughout the supply chains can help ensure that trade is legal, protected species remain off the market and consumers can make informed consumption choices (Fox et al., 2018; Niedermüller et al., 2021; Hasan et al., 2023). Due to data paucity, countries often consolidate elasmobranch catch data into aggregated categories (such as sharks nei) when reporting to the Food and Agriculture Organization of the United Nations (FAO). Similarly, trade data gets consolidated under aggregated commodity categories, combing various product types and species (Musick and Musick, 2011; Dent and Clarke, 2015; Barone and Friedman, 2021; Fowler et al., 2021).This approach presents evident challenges in establishing traceability and distinguishing between fin and meat markets. Furthermore, as an increasing number of shark species are listed under CITES Appendix II, necessitating more transparency, there is a growing imperative among Parties to establish reliable species-specific catch and trade baselines. Most coastal nations border one ocean and elasmobranch landings are thus drawn from species and population(s) from that ocean. Some Central American nations have both a Pacific and Atlantic coast, which means fisheries landings can include Atlantic Ocean species, Pacific Ocean species, and Atlantic or Pacific Ocean individuals of cosmopolitan species. National level species-specific landings and trade information is growing in the region, in part due to listing of many elasmobranchs on CITES. However, bicoastal Central American nations have a need to further separate species-specific landings to Atlantic Ocean or Pacific Ocean populations to properly assess and manage their fisheries. Guatemala exemplifies this scenario. Here, religious practices and culinary traditions intensify demand for salt-preserved and fresh elasmobranch meat during the Roman Catholic Lenten season (Clementi et al., 2020; Sabbagh and Hickey, 2020; Quinlan et al., 2021). The nation meets this demand for elasmobranch meat with a combination of imports in addition to their domestic artisanal elasmobranch fisheries operating both in the Pacific Ocean and the Caribbean Sea (Hacohen-Domen´e et al., 2020; Castillo and Morales, 2021; S´anchez et al., 2023). The domestic market for elasmobranch meat in Guatemala therefore is a combination of bicoastal domestic fisheries in addition to international imports (Hacohen-Domen´e et al., 2020; Sabbagh and Hickey, 2020; Castillo and Morales, 2021). Despite significant consumption, elasmobranch meat trade remains largely unmonitored and unregulated in Guatemala with very little information on species and quantities landed and traded. Vulnerability to fishing is species-dependent, underscoring the need for species-specific catch and trade data for successful management interventions and conservation (Abercrombie et al., 2005; Clarke et al., 2006; Davidson et al., 2016; Dulvy et al., 2017). Additionally, “DNA zip coding” (Fields et al., 2020; Carde˜nosa et al., 2020a, 2020b) can establish ocean basin provenance of products, allowing bicoastal nations to identify critical trade routes and tailor management decision-making for each exploited population. This information is crucial for resource managers aiming to establish legal, traceable, and sustainable trade practices. Silky sharks (Carcharhinus falciformis), which are known to dominate landings on both the Atlantic and Pacific coasts (Ixquiac Cabrera et al., 2009; Hacohen-Domen´e et al., 2020), are a strong example to illustrate this approach due to their cosmopolitan distribution. To date, elasmobranch meat trade has been characterized using a combination of survey methods (e.g. market, fisher knowledge, traders) (Jabado et al., 2015; Karnad et al., 2020; Haque et al., 2021) and genetic approaches to identify shark species and products that are morphologically difficult to identify (Liu et al., 2013; Almer´on-Souza et al., 2018; Wainwright et al., 2018; Pazartzi et al., 2019). Understanding domestic markets for elasmobranchs in Guatemala has implications for the management of domestic fisheries, the implementation of and compliance with international trade regulations such as CITES, and the conservation of species supplying this demand. Using molecular techniques, the aims of this study were to (1) establish a species-specific baseline for shark and ray meat in domestic trade; (2) evaluate the conservation status of species in the markets; and (3) assess the geographic origin of a key species (silky shark, Carcharhinus falciformis) and relative contribution of Atlantic and Pacific Ocean basins respectively. Materials and methods Sample collection and DNA extraction Domestic fish markets selling shark meat in Guatemala were identified based on extensive preliminary work and recommendations from our collaborators at Fundaci´on Mundo Azul, who conducted groundwork to pinpoint markets of significant scale. Six key cities with major fish markets that received shark meat from landing sites and other local markets from both the Atlantic and the Pacific were selected (Fig. 1). This ensured an adequate bicoastal coverage of the pool of species that are available to a domestic consumer in Guatemala. Markets were defined as point of sale and therefore, included organized markets with several shops in an area as well as independent vendors operating outside such formal arrangements. Using convenience sampling, a form of non-probability sampling to select participants (Newing et al., 2011), researchers identified and sampled all available and willing vendors selling shark meat products. The project purpose, along with anonymity and confidentiality measures, was explained to the vendors. To avoid sample redundancy and double-sampling, at each vendor we sampled products sold as elasmobranch fillets that i) could be visually differentiated from the others or, ii) were sold as different products (fresh versus salted) or, iii) were specifically identified by the vendor as being distinct (i.e. differently labelled). A total of 145 samples of fresh and salted sharks and rays were collected from fish markets in Guatemala in April 2022. We also obtained samples collected non-probabilistically from various additional markets and seafood gathering centers in Guatemala, provided by collaborators at Fundaci´on Mundo Azul. These included 146 samples from 2016 and 116 samples from 2017. All DNA samples were procured and transported for laboratory analyses under appropriate research and export permits from Consejo Nacional de ´Areas Protegidas (CONAP) Guatemala #I_DRO-002–2021, Belize Fisheries Department and approved animal care protocol exemption #IACUC-21–071. Samples were preserved in 95 % ethanol and then kept in −20˚C until further analysis. Using 0.010 – 0.025 g of tissue, genomic DNA was extracted from each sample. This was done using the Qiagen DNAeasy tissue kit and following the manufacturer’s instruction for animal tissue protocol (QIAGEN, Valencia, CA, USA). Following extraction, a 600–650 bp region of the mitochondrial cytochrome c oxidase subunit I gene (COI) was amplified using universal primers FishCoxI F (5’TCWACCAACCACAAGAYATYGGCAC3’) and FishCoxI R (5’TARACTTCWGGGTGRCCRAAGAATCA3’), modified from Ward et al. (2005). Each 25 µL Polymerase Chain Reaction (PCR) included 0.5 μL of extracted DNA, 12.5 μL of GoTaq Hot Start Green Master Mix (Promega, Madison, WI, USA), 10.5 μL of DNase/RNase-free water (Fisher Scientific), and 0.75 μL of each forward and reverse primers from a 10 μM stock solution. PCR was conducted with the following thermal cycling profile: an initial denaturation at 94 ◦C for 10 min. PCR products were checked for amplification on a 1.5 % agarose gel, purified using ExoSAP-IT (ThermoFisher Scientific, Waltham, MA, USA) and sequenced in both directions using the BigDye Terminator v3.1 Cycle Sequencing Kit (ThermoFisher Scientific). Sequences were cleaned with an ethanol precipitation and run on an ABI 3730xl DNA Analyzer (Applied Biosystems). All forward and reverse sequences were reviewed, edited manually and aligned using the MUSCLE algorithm in Geneious v.3.6.1 (http://www.geneious.com). Using search algorithms, the resulting sequences were used as queries against
View PDF -
New records and morphometry of the Atlantic sixgill shark Hexanchus vitulus in the Caribbean coast of Guatemala
First records and measurements of ten Atlantic sixgill sharks captured by artisanal fishers in the Guatemalan Caribbean from 2015 to 2019.
View PDF -
Description and characterization of the artisanal elasmobranch fishery on Guatemala’s Caribbean coast
Study of shark, ray and chimaera landings at El Quetzalito and Livingston from 2015 to 2017.
View PDF -
Characterization of the artisanal elasmobranch fisheries off the Pacific coast of Guatemala
Monitoring of shark and ray landings at Las Lisas, Sipacate and Buena Vista from 2017 to 2020.
View PDF -
First report of the whitesaddled catshark Scyliorhinus hesperius (Springer 1966) in Guatemala’s Caribbean Sea
First Guatemalan record of five mature male whitesaddled catsharks captured at 200 m depth.
View PDF -
First record of Heptranchias perlo (Bonnaterre 1788) in Guatemala’s Caribbean Sea
First confirmed record of the sharpnose sevengill shark Heptranchias perlo in Guatemala's Caribbean Sea, based on two females captured near El Quetzalito at approximately 200 m depth.
View PDF -
First record of the chimaera Neoharriotta carri (Bullis and Carpenter 1966) in the Caribbean of Guatemala
First Guatemalan records of a male and female chimaera captured off El Quetzalito.
View PDF -
Elasmobranchs small-scale fishery in Guatemala: Socioeconomic aspects and value chain structure
Socioeconomic and value-chain analysis of small-scale shark and ray fisheries in Guatemala.
View PDF
